Incidental Mutation 'R3826:Srrm3'
ID275400
Institutional Source Beutler Lab
Gene Symbol Srrm3
Ensembl Gene ENSMUSG00000039860
Gene Nameserine/arginine repetitive matrix 3
Synonyms2900083I11Rik, Srrm2l, SRm300-like
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock #R3826 (G1)
Quality Score176
Status Validated
Chromosome5
Chromosomal Location135806890-135874772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135857214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 336 (D336G)
Ref Sequence ENSEMBL: ENSMUSP00000115695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013615] [ENSMUST00000126232] [ENSMUST00000144211]
Predicted Effect probably damaging
Transcript: ENSMUST00000013615
AA Change: D336G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013615
Gene: ENSMUSG00000039860
AA Change: D336G

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126232
SMART Domains Protein: ENSMUSP00000122821
Gene: ENSMUSG00000039860

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135615
Predicted Effect probably damaging
Transcript: ENSMUST00000144211
AA Change: D336G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115695
Gene: ENSMUSG00000039860
AA Change: D336G

DomainStartEndE-ValueType
low complexity region 34 43 N/A INTRINSIC
cwf21 55 100 8.92e-17 SMART
internal_repeat_1 122 142 4.3e-6 PROSPERO
low complexity region 160 186 N/A INTRINSIC
low complexity region 200 242 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
low complexity region 286 317 N/A INTRINSIC
internal_repeat_1 325 345 4.3e-6 PROSPERO
low complexity region 362 442 N/A INTRINSIC
low complexity region 451 478 N/A INTRINSIC
low complexity region 493 508 N/A INTRINSIC
Pfam:SRRM_C 520 584 1.9e-28 PFAM
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Srrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Srrm3 APN 5 135835249 missense probably damaging 1.00
IGL02716:Srrm3 APN 5 135854433 splice site probably null
IGL03099:Srrm3 APN 5 135869298 splice site probably benign
P0047:Srrm3 UTSW 5 135852926 splice site probably null
R0688:Srrm3 UTSW 5 135869276 utr 3 prime probably benign
R0811:Srrm3 UTSW 5 135873282 unclassified probably benign
R0812:Srrm3 UTSW 5 135873282 unclassified probably benign
R1083:Srrm3 UTSW 5 135854409 missense probably damaging 0.99
R1161:Srrm3 UTSW 5 135854392 small deletion probably benign
R1656:Srrm3 UTSW 5 135835038 critical splice acceptor site probably null
R1694:Srrm3 UTSW 5 135873225 unclassified probably benign
R1803:Srrm3 UTSW 5 135857129 missense probably damaging 0.99
R2037:Srrm3 UTSW 5 135854377 missense probably damaging 1.00
R2436:Srrm3 UTSW 5 135835176 nonsense probably null
R3829:Srrm3 UTSW 5 135857214 missense probably damaging 0.99
R4840:Srrm3 UTSW 5 135854595 missense possibly damaging 0.81
R6526:Srrm3 UTSW 5 135835234 missense probably damaging 1.00
R6843:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R7408:Srrm3 UTSW 5 135852206 missense probably benign 0.04
R7583:Srrm3 UTSW 5 135852281 missense probably benign 0.01
R8096:Srrm3 UTSW 5 135869240 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACCAGGTCAGTTGCAGAG -3'
(R):5'- CTCCTTGTAGAGCACAGGTC -3'

Sequencing Primer
(F):5'- TCTGCTCCCCCAGACTGAG -3'
(R):5'- CCTTGTAGAGCACAGGTCAGAGG -3'
Posted On2015-04-02