Mutagenetix > Incidental Mutations

Incidental Mutation 'R3826:Chd2'

275407

Institutional Source

Beutler Lab

Gene Symbol

Chd2

Ensembl Gene

ENSMUSG00000078671

Gene Name

chromodomain helicase DNA binding protein 2

Synonyms

2810040A01Rik, 2810013C04Rik, 5630401D06Rik

Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene?

Possibly essential (E-score: 0.561) question?

Stock #

R3826 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73426638-73541830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73491415 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 577 (Y577H)

Ref Sequence

ENSEMBL: ENSMUSP00000126352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169922]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169922
AA Change: Y577H

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: Y577H

Domain	Start	End	E-Value	Type
low complexity region	13	75	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	126	136	N/A	INTRINSIC
low complexity region	176	196	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
CHROMO	260	346	3.64e-19	SMART
CHROMO	376	449	7.99e-16	SMART
DEXDc	480	677	1.93e-37	SMART
Blast:DEXDc	678	729	2e-18	BLAST
low complexity region	793	806	N/A	INTRINSIC
HELICc	821	905	1.2e-24	SMART
Blast:DEXDc	960	1244	4e-63	BLAST
PDB:4B4C\|A	1128	1316	5e-78	PDB
low complexity region	1317	1329	N/A	INTRINSIC
low complexity region	1338	1351	N/A	INTRINSIC
low complexity region	1389	1403	N/A	INTRINSIC
low complexity region	1407	1441	N/A	INTRINSIC
DUF4208	1451	1555	1.85e-52	SMART
low complexity region	1557	1572	N/A	INTRINSIC
low complexity region	1704	1729	N/A	INTRINSIC

Meta Mutation Damage Score

0.1488

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.3%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]

Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	T	C	5: 137,567,273	L377P	probably damaging	Het
Apc	C	A	18: 34,279,335	Q236K	possibly damaging	Het
Atn1	G	A	6: 124,746,219		probably benign	Het
C130079G13Rik	T	A	3: 59,936,475	S197T	possibly damaging	Het
Ccr3	A	G	9: 124,029,677	T350A	possibly damaging	Het
Cdc42bpg	T	C	19: 6,317,645	V1015A	probably damaging	Het
Col1a2	A	G	6: 4,516,960		probably benign	Het
Col4a1	C	A	8: 11,209,650	G1341V	probably damaging	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Cx3cl1	A	T	8: 94,777,306		probably benign	Het
Dhx37	T	C	5: 125,431,613	K86R	probably benign	Het
Dlec1	T	C	9: 119,143,061		probably benign	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
Fam234a	T	C	17: 26,218,189	E172G	probably benign	Het
Ffar2	A	T	7: 30,820,085	I10N	possibly damaging	Het
Gas2	T	C	7: 51,936,619		probably null	Het
Gm9573	A	G	17: 35,621,612		probably benign	Het
Gpat4	G	A	8: 23,180,155	P286L	probably damaging	Het
Grpel1	T	A	5: 36,469,483	N36K	probably benign	Het
Hgfac	C	A	5: 35,048,162	D595E	probably damaging	Het
Kcnj10	A	T	1: 172,370,049	S377C	probably damaging	Het
Kcnq2	C	T	2: 181,104,900	V369I	possibly damaging	Het
Kcnt1	T	C	2: 25,915,868		probably null	Het
Lpcat1	T	C	13: 73,489,093	I114T	possibly damaging	Het
Mast4	G	T	13: 102,738,811	H1350N	probably damaging	Het
Mcts1	T	C	X: 38,602,568		probably benign	Het
Myg1	G	C	15: 102,337,736	G349R	probably damaging	Het
Ncor2	T	C	5: 125,118,692		probably benign	Het
Olfr1015	C	T	2: 85,786,215	R235*	probably null	Het
Olfr1102	T	A	2: 87,002,044	I25K	probably damaging	Het
Olfr99	T	A	17: 37,280,249	Y57F	probably damaging	Het
Panx2	A	G	15: 89,068,461	D377G	probably damaging	Het
Pcdhb10	C	A	18: 37,412,417	T182N	probably damaging	Het
Pdha2	G	T	3: 141,211,128	F206L	possibly damaging	Het
Pgd	T	C	4: 149,166,004		probably benign	Het
Pgs1	C	T	11: 118,019,758		probably null	Het
Rere	T	C	4: 150,470,328	V161A	probably benign	Het
Rgs12	G	A	5: 34,966,015	V381M	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Rsg1	C	T	4: 141,218,589	R148C	probably damaging	Het
Rsph6a	T	C	7: 19,057,614	L236P	probably damaging	Het
Rtkn2	A	T	10: 67,997,626		probably null	Het
Rubcnl	C	T	14: 75,032,225	L108F	possibly damaging	Het
Sap18b	T	C	8: 95,825,557	F65S	probably damaging	Het
Scap	A	G	9: 110,381,297	M925V	probably benign	Het
Slc7a8	A	G	14: 54,737,572	I200T	probably damaging	Het
Srrm3	A	G	5: 135,857,214	D336G	probably damaging	Het
Stk11	T	C	10: 80,127,948		probably null	Het
Tiam2	C	G	17: 3,507,701		probably benign	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Trio	T	A	15: 27,833,070	K75N	probably damaging	Het
Tspan18	T	C	2: 93,220,108	I57V	probably benign	Het
Ube3b	C	A	5: 114,399,951	Q368K	probably damaging	Het
Zfhx4	A	T	3: 5,401,209	K2142N	probably damaging	Het
Zfp37	T	C	4: 62,192,563	N88S	probably benign	Het
Zswim8	C	T	14: 20,711,089	R142*	probably null	Het

Other mutations in Chd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Chd2	APN	7	73468577	missense	probably damaging	0.99
IGL00535:Chd2	APN	7	73540828	missense	probably benign	0.01
IGL00961:Chd2	APN	7	73444249	missense	probably damaging	0.99
IGL01092:Chd2	APN	7	73441686	missense	possibly damaging	0.69
IGL02035:Chd2	APN	7	73441627	splice site	probably null
IGL02083:Chd2	APN	7	73481068	missense	possibly damaging	0.95
IGL02205:Chd2	APN	7	73441717	missense	probably benign	0.01
IGL02243:Chd2	APN	7	73497708	splice site	probably null
IGL02385:Chd2	APN	7	73435822	missense	probably damaging	1.00
IGL02552:Chd2	APN	7	73447320	unclassified	probably benign
IGL02590:Chd2	APN	7	73453200	missense	probably benign	0.00
IGL02684:Chd2	APN	7	73475349	missense	probably damaging	0.99
IGL02731:Chd2	APN	7	73493456	missense	probably damaging	0.99
IGL03272:Chd2	APN	7	73453166	missense	possibly damaging	0.94
1mM(1):Chd2	UTSW	7	73502104	missense	possibly damaging	0.65
A4554:Chd2	UTSW	7	73480968	missense	probably benign
F6893:Chd2	UTSW	7	73507872	missense	possibly damaging	0.92
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0012:Chd2	UTSW	7	73455519	missense	probably damaging	1.00
R0068:Chd2	UTSW	7	73484534	missense	probably damaging	1.00
R0763:Chd2	UTSW	7	73447274	missense	possibly damaging	0.74
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0973:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R0974:Chd2	UTSW	7	73478664	missense	probably damaging	1.00
R1223:Chd2	UTSW	7	73484517	missense	probably damaging	1.00
R1435:Chd2	UTSW	7	73453136	missense	probably damaging	0.99
R1527:Chd2	UTSW	7	73490614	nonsense	probably null
R1599:Chd2	UTSW	7	73473051	missense	probably benign	0.05
R1657:Chd2	UTSW	7	73480430	missense	probably damaging	1.00
R1932:Chd2	UTSW	7	73454445	missense	probably damaging	0.99
R2110:Chd2	UTSW	7	73429987	missense	probably benign	0.00
R2202:Chd2	UTSW	7	73478668	missense	probably benign	0.00
R2383:Chd2	UTSW	7	73503420	missense	possibly damaging	0.89
R2393:Chd2	UTSW	7	73507883	missense	possibly damaging	0.92
R3699:Chd2	UTSW	7	73468490	missense	probably benign	0.35
R3713:Chd2	UTSW	7	73471790	unclassified	probably benign
R3788:Chd2	UTSW	7	73447130	unclassified	probably benign
R3828:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3830:Chd2	UTSW	7	73491415	missense	possibly damaging	0.71
R3966:Chd2	UTSW	7	73464395	splice site	probably benign
R4093:Chd2	UTSW	7	73501016	missense	possibly damaging	0.70
R4431:Chd2	UTSW	7	73435961	missense	possibly damaging	0.56
R4461:Chd2	UTSW	7	73540874	intron	probably benign
R4782:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4791:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4792:Chd2	UTSW	7	73468577	missense	probably benign	0.13
R4799:Chd2	UTSW	7	73484436	missense	possibly damaging	0.80
R4832:Chd2	UTSW	7	73502125	missense	probably damaging	1.00
R5055:Chd2	UTSW	7	73480508	missense	probably damaging	1.00
R5071:Chd2	UTSW	7	73429689	missense	probably benign	0.03
R5328:Chd2	UTSW	7	73463681	missense	possibly damaging	0.96
R5444:Chd2	UTSW	7	73473085	missense	probably damaging	1.00
R5643:Chd2	UTSW	7	73484484	missense	probably damaging	1.00
R5666:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5670:Chd2	UTSW	7	73441717	missense	probably benign	0.01
R5706:Chd2	UTSW	7	73491357	missense	possibly damaging	0.74
R5825:Chd2	UTSW	7	73484602	splice site	probably null
R5834:Chd2	UTSW	7	73478715	missense	probably damaging	1.00
R5920:Chd2	UTSW	7	73537312	missense	probably damaging	0.97
R6051:Chd2	UTSW	7	73435842	missense	probably benign	0.00
R6179:Chd2	UTSW	7	73444323	missense	probably damaging	0.98
R6229:Chd2	UTSW	7	73451723	missense	possibly damaging	0.76
R6267:Chd2	UTSW	7	73463671	missense	probably damaging	0.99
R6310:Chd2	UTSW	7	73453164	missense	probably damaging	1.00
R6439:Chd2	UTSW	7	73480406	missense	probably damaging	1.00
R6444:Chd2	UTSW	7	73501037	critical splice acceptor site	probably null
R6529:Chd2	UTSW	7	73503443	missense	possibly damaging	0.89
R6611:Chd2	UTSW	7	73493565	missense	probably damaging	0.99
R6661:Chd2	UTSW	7	73490482	missense	possibly damaging	0.95
R6782:Chd2	UTSW	7	73475379	nonsense	probably null
R6860:Chd2	UTSW	7	73497810	missense	possibly damaging	0.95
R6955:Chd2	UTSW	7	73475423	missense	probably damaging	1.00
R6984:Chd2	UTSW	7	73484411	nonsense	probably null
R7095:Chd2	UTSW	7	73471881	missense	probably damaging	1.00
R7121:Chd2	UTSW	7	73469670	missense	probably benign	0.00
R7179:Chd2	UTSW	7	73475420	missense	probably damaging	1.00
R7500:Chd2	UTSW	7	73451808	missense	probably damaging	1.00
R7615:Chd2	UTSW	7	73441642	missense	probably damaging	0.97
R7646:Chd2	UTSW	7	73435773	missense	possibly damaging	0.49
R7764:Chd2	UTSW	7	73471819	missense	probably null	1.00
R7898:Chd2	UTSW	7	73519475	critical splice donor site	probably null
R7935:Chd2	UTSW	7	73499625	missense	probably benign	0.01
R8033:Chd2	UTSW	7	73435880	missense	probably damaging	1.00
R8070:Chd2	UTSW	7	73451758	missense	probably benign
R8071:Chd2	UTSW	7	73537384	missense	probably benign
R8188:Chd2	UTSW	7	73429756	nonsense	probably null
R8196:Chd2	UTSW	7	73468537	missense	probably benign	0.00
R8258:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8259:Chd2	UTSW	7	73435784	missense	probably benign	0.11
R8357:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
R8457:Chd2	UTSW	7	73447237	missense	probably damaging	0.99
RF009:Chd2	UTSW	7	73519662	missense	possibly damaging	0.73
X0025:Chd2	UTSW	7	73507837	missense	probably benign	0.11
Z1177:Chd2	UTSW	7	73468586	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- CTAAGCTCCCATACGGTGAG -3'
(R):5'- TTCTAGCTTGGGTTACAGCAAG -3'

Sequencing Primer
(F):5'- GTTTCACCTTTTAAACGGAGCAAG -3'
(R):5'- CAGCAAGTCTTCTTAGAGTGCATAGG -3'

Posted On

2015-04-02