Incidental Mutation 'R3826:Stk11'
ID275418
Institutional Source Beutler Lab
Gene Symbol Stk11
Ensembl Gene ENSMUSG00000003068
Gene Nameserine/threonine kinase 11
SynonymsPar-4, Lkb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80115803-80130682 bp(+) (GRCm38)
Type of Mutationunclassified (2503 bp from exon)
DNA Base Change (assembly) T to C at 80127948 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000169546] [ENSMUST00000170219] [ENSMUST00000213772]
Predicted Effect probably damaging
Transcript: ENSMUST00000003152
AA Change: I322T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068
AA Change: I322T

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105369
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105370
AA Change: I196T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068
AA Change: I196T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144119
Predicted Effect probably damaging
Transcript: ENSMUST00000144883
AA Change: I322T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068
AA Change: I322T

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146180
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152592
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169546
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170219
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213772
AA Change: I322T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.1523 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a member of the serine/threonine kinase family. The encoded protein, a known tumor suppressor, activates (via phosphorylation) adenine monophosphate-activated protein kinase (AMPK) and AMPK-related kinase proteins. This upstream regulation of the AMPK pathway is thought to regulate a number of different processes, including cell metabolism, cell polarity, apoptosis and DNA damage response. Mutations in a similar gene in human have been associated with Peutz-Jeghers syndrome. Alternative splicing results in multiple transcript variants, including the S isoform which plays a potential role in spermiogenesis. [provided by RefSeq, Sep 2014]
PHENOTYPE: Targeted heterozygous mutants with one inactivated allele develop benign gastrointestinal polyps. Homozygous null mutant are embryonic lethal. Homozygotes for a hypomorphic allele survive and apparently normal, but male mice are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Stk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02695:Stk11 APN 10 80125477 critical splice acceptor site probably null
IGL03055:Stk11 UTSW 10 80128086 missense probably damaging 1.00
R0450:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0469:Stk11 UTSW 10 80126086 missense probably damaging 1.00
R0501:Stk11 UTSW 10 80126285 missense probably damaging 1.00
R3827:Stk11 UTSW 10 80127948 unclassified probably null
R3828:Stk11 UTSW 10 80127948 unclassified probably null
R3829:Stk11 UTSW 10 80127948 unclassified probably null
R4512:Stk11 UTSW 10 80126377 splice site probably benign
R4515:Stk11 UTSW 10 80116601 unclassified probably benign
R5123:Stk11 UTSW 10 80127941 missense probably damaging 1.00
R5188:Stk11 UTSW 10 80126279 missense probably damaging 1.00
R5341:Stk11 UTSW 10 80126260 missense probably benign 0.13
R5540:Stk11 UTSW 10 80126049 missense probably benign 0.00
R6856:Stk11 UTSW 10 80128090 missense probably benign 0.01
R7213:Stk11 UTSW 10 80116618 start codon destroyed probably null 0.05
R7792:Stk11 UTSW 10 80125437 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCTATGGGTGTTAGGCTACC -3'
(R):5'- GAGTGCACAAAGTCACCAGC -3'

Sequencing Primer
(F):5'- GGTGTTAGGCTACCTCAAGC -3'
(R):5'- AGTCACCAGCTCCAGTAGG -3'
Posted On2015-04-02