Incidental Mutation 'R3826:Pgs1'
ID275421
Institutional Source Beutler Lab
Gene Symbol Pgs1
Ensembl Gene ENSMUSG00000017715
Gene Namephosphatidylglycerophosphate synthase 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117986292-118024011 bp(+) (GRCm38)
Type of Mutationintron (26 bp from exon)
DNA Base Change (assembly) C to T at 118019758 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000100185] [ENSMUST00000106308] [ENSMUST00000132676] [ENSMUST00000132685]
Predicted Effect probably benign
Transcript: ENSMUST00000017859
SMART Domains Protein: ENSMUSP00000017859
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 11 56 N/A INTRINSIC
SCOP:d1f0ia1 70 287 4e-25 SMART
PDB:3HSI|C 81 464 7e-8 PDB
Blast:PLDc 211 237 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084803
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100185
SMART Domains Protein: ENSMUSP00000097760
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
SCOP:d1f0ia1 18 158 7e-13 SMART
Blast:PLDc 82 108 1e-8 BLAST
low complexity region 202 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106308
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132676
SMART Domains Protein: ENSMUSP00000121973
Gene: ENSMUSG00000017715

DomainStartEndE-ValueType
low complexity region 12 57 N/A INTRINSIC
SCOP:d1f0ia1 71 288 3e-25 SMART
PDB:3HSI|C 82 475 3e-9 PDB
Blast:PLDc 212 238 2e-8 BLAST
Blast:PLDc 459 490 1e-13 BLAST
low complexity region 508 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132685
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155507
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Pgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Pgs1 APN 11 118005540 missense probably benign 0.07
R1703:Pgs1 UTSW 11 118014728 splice site probably benign
R1747:Pgs1 UTSW 11 118001631 missense probably benign 0.15
R1938:Pgs1 UTSW 11 118005727 missense probably damaging 1.00
R2023:Pgs1 UTSW 11 118002402 missense probably benign 0.00
R2066:Pgs1 UTSW 11 118014570 splice site probably benign
R3915:Pgs1 UTSW 11 118019646 missense probably benign
R4201:Pgs1 UTSW 11 118002536 missense probably damaging 1.00
R4660:Pgs1 UTSW 11 118019677 missense probably damaging 0.97
R4668:Pgs1 UTSW 11 118003507 missense probably damaging 0.99
R4718:Pgs1 UTSW 11 118005883 missense probably damaging 1.00
R4972:Pgs1 UTSW 11 118005893 critical splice donor site probably null
R4974:Pgs1 UTSW 11 118005519 missense probably benign 0.00
R5414:Pgs1 UTSW 11 118014676 missense probably damaging 0.98
R6053:Pgs1 UTSW 11 118001709 missense probably damaging 1.00
R6382:Pgs1 UTSW 11 118003360 missense probably damaging 1.00
R7030:Pgs1 UTSW 11 118002486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAGGTGTCTAGGAACCAC -3'
(R):5'- AGATAGGTGAAGCTGGCCTC -3'

Sequencing Primer
(F):5'- TGTCTAGGAACCACAGAGTGACC -3'
(R):5'- TGAAGCTGGCCTCACCACAG -3'
Posted On2015-04-02