Incidental Mutation 'R3826:Rubcnl'
ID275428
Institutional Source Beutler Lab
Gene Symbol Rubcnl
Ensembl Gene ENSMUSG00000034959
Gene NameRUN and cysteine rich domain containing beclin 1 interacting protein like
SynonymsLOC380917, 5031414D18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75016027-75052532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75032225 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 108 (L108F)
Ref Sequence ENSEMBL: ENSMUSP00000045566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036072
AA Change: L108F

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045566
Gene: ENSMUSG00000034959
AA Change: L108F

DomainStartEndE-ValueType
DUF4206 463 664 1.01e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228689
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Rubcnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02571:Rubcnl APN 14 75032136 missense possibly damaging 0.75
IGL02730:Rubcnl APN 14 75050148 missense probably damaging 1.00
R0019:Rubcnl UTSW 14 75048263 splice site probably benign
R0147:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0148:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0350:Rubcnl UTSW 14 75040891 missense probably damaging 0.99
R0487:Rubcnl UTSW 14 75036081 missense probably benign 0.18
R0558:Rubcnl UTSW 14 75047547 missense probably damaging 1.00
R1537:Rubcnl UTSW 14 75040827 missense possibly damaging 0.92
R1791:Rubcnl UTSW 14 75047549 missense probably damaging 1.00
R1871:Rubcnl UTSW 14 75042409 missense possibly damaging 0.58
R2227:Rubcnl UTSW 14 75042392 missense probably benign 0.00
R2263:Rubcnl UTSW 14 75040820 missense possibly damaging 0.93
R2910:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R2911:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R3870:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R3871:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R4007:Rubcnl UTSW 14 75049703 missense possibly damaging 0.93
R4161:Rubcnl UTSW 14 75044458 missense possibly damaging 0.82
R5004:Rubcnl UTSW 14 75032177 nonsense probably null
R5041:Rubcnl UTSW 14 75050132 missense probably damaging 1.00
R5468:Rubcnl UTSW 14 75032031 missense possibly damaging 0.49
R5495:Rubcnl UTSW 14 75042337 missense possibly damaging 0.61
R5739:Rubcnl UTSW 14 75040941 splice site probably null
R5910:Rubcnl UTSW 14 75035472 missense probably benign 0.26
R5948:Rubcnl UTSW 14 75047616 missense probably damaging 1.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6197:Rubcnl UTSW 14 75031929 missense probably damaging 0.99
R6297:Rubcnl UTSW 14 75050144 missense probably benign 0.06
R6372:Rubcnl UTSW 14 75047569 missense probably damaging 0.99
R6376:Rubcnl UTSW 14 75032394 missense probably benign 0.01
R6377:Rubcnl UTSW 14 75050195 splice site probably null
R6724:Rubcnl UTSW 14 75052010 missense probably benign 0.00
R6884:Rubcnl UTSW 14 75035470 missense probably benign 0.23
R7183:Rubcnl UTSW 14 75049626 missense probably damaging 0.97
R7186:Rubcnl UTSW 14 75032013 missense possibly damaging 0.91
R7345:Rubcnl UTSW 14 75042353 missense probably benign
R7423:Rubcnl UTSW 14 75049643 missense probably benign 0.09
R7548:Rubcnl UTSW 14 75042352 missense probably benign
R7606:Rubcnl UTSW 14 75038874 missense probably benign 0.41
R7699:Rubcnl UTSW 14 75031964 missense probably benign
R7781:Rubcnl UTSW 14 75032090 missense probably damaging 1.00
R8406:Rubcnl UTSW 14 75051985 missense probably damaging 1.00
RF011:Rubcnl UTSW 14 75044438 missense probably damaging 0.99
Z1176:Rubcnl UTSW 14 75036197 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACACTGACCAACCTGCTTGC -3'
(R):5'- TCTGTAGAAGCTGTCAAATGAGGAG -3'

Sequencing Primer
(F):5'- AACCTGCTTGCCAATTGGATG -3'
(R):5'- AAGTGGCCACAGTCTTGG -3'
Posted On2015-04-02