Incidental Mutation 'R3826:Myg1'
ID275431
Institutional Source Beutler Lab
Gene Symbol Myg1
Ensembl Gene ENSMUSG00000001285
Gene Namemelanocyte proliferating gene 1
SynonymsGamm1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3826 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102331709-102338139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 102337736 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 349 (G349R)
Ref Sequence ENSEMBL: ENSMUSP00000109312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001331] [ENSMUST00000041208] [ENSMUST00000113682] [ENSMUST00000228959] [ENSMUST00000229900] [ENSMUST00000230481] [ENSMUST00000231061]
Predicted Effect probably damaging
Transcript: ENSMUST00000001331
AA Change: G295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001331
Gene: ENSMUSG00000001285
AA Change: G295R

DomainStartEndE-ValueType
Pfam:UPF0160 41 161 4.8e-54 PFAM
Pfam:UPF0160 158 312 1.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041208
SMART Domains Protein: ENSMUSP00000044604
Gene: ENSMUSG00000036678

DomainStartEndE-ValueType
WD40 136 179 3.7e0 SMART
WD40 181 221 4.75e1 SMART
WD40 232 273 1.17e-5 SMART
WD40 278 315 2.66e0 SMART
Blast:WD40 319 357 2e-15 BLAST
low complexity region 534 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113682
AA Change: G349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109312
Gene: ENSMUSG00000001285
AA Change: G349R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UPF0160 45 365 1.5e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170713
Predicted Effect unknown
Transcript: ENSMUST00000171244
AA Change: G303R
SMART Domains Protein: ENSMUSP00000129494
Gene: ENSMUSG00000001285
AA Change: G303R

DomainStartEndE-ValueType
Pfam:UPF0160 41 209 1.7e-76 PFAM
Pfam:UPF0160 204 306 3.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171733
Predicted Effect probably benign
Transcript: ENSMUST00000228959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229589
Predicted Effect probably benign
Transcript: ENSMUST00000229900
Predicted Effect probably benign
Transcript: ENSMUST00000230239
Predicted Effect probably benign
Transcript: ENSMUST00000230406
Predicted Effect probably benign
Transcript: ENSMUST00000230481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230812
Predicted Effect probably benign
Transcript: ENSMUST00000231061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231099
Meta Mutation Damage Score 0.9645 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display no gross abnormalities but altered sex-dependent anxiety-like behaviors in different tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,567,273 L377P probably damaging Het
Apc C A 18: 34,279,335 Q236K possibly damaging Het
Atn1 G A 6: 124,746,219 probably benign Het
C130079G13Rik T A 3: 59,936,475 S197T possibly damaging Het
Ccr3 A G 9: 124,029,677 T350A possibly damaging Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Chd2 A G 7: 73,491,415 Y577H possibly damaging Het
Col1a2 A G 6: 4,516,960 probably benign Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dlec1 T C 9: 119,143,061 probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gas2 T C 7: 51,936,619 probably null Het
Gm9573 A G 17: 35,621,612 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hgfac C A 5: 35,048,162 D595E probably damaging Het
Kcnj10 A T 1: 172,370,049 S377C probably damaging Het
Kcnq2 C T 2: 181,104,900 V369I possibly damaging Het
Kcnt1 T C 2: 25,915,868 probably null Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mcts1 T C X: 38,602,568 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Olfr1015 C T 2: 85,786,215 R235* probably null Het
Olfr1102 T A 2: 87,002,044 I25K probably damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Panx2 A G 15: 89,068,461 D377G probably damaging Het
Pcdhb10 C A 18: 37,412,417 T182N probably damaging Het
Pdha2 G T 3: 141,211,128 F206L possibly damaging Het
Pgd T C 4: 149,166,004 probably benign Het
Pgs1 C T 11: 118,019,758 probably null Het
Rere T C 4: 150,470,328 V161A probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Rubcnl C T 14: 75,032,225 L108F possibly damaging Het
Sap18b T C 8: 95,825,557 F65S probably damaging Het
Scap A G 9: 110,381,297 M925V probably benign Het
Slc7a8 A G 14: 54,737,572 I200T probably damaging Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Trio T A 15: 27,833,070 K75N probably damaging Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Zfp37 T C 4: 62,192,563 N88S probably benign Het
Zswim8 C T 14: 20,711,089 R142* probably null Het
Other mutations in Myg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Myg1 APN 15 102334338 missense probably benign 0.00
IGL02188:Myg1 APN 15 102337441 missense probably benign 0.08
IGL02373:Myg1 APN 15 102336833 missense probably damaging 0.99
IGL02885:Myg1 APN 15 102332159 missense probably damaging 1.00
IGL03066:Myg1 APN 15 102334366 unclassified probably benign
R0583:Myg1 UTSW 15 102337790 nonsense probably null
R0631:Myg1 UTSW 15 102331849 missense probably benign 0.00
R0835:Myg1 UTSW 15 102332102 missense probably damaging 1.00
R1016:Myg1 UTSW 15 102334351 missense possibly damaging 0.50
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1466:Myg1 UTSW 15 102337390 missense probably damaging 1.00
R1757:Myg1 UTSW 15 102331829 missense probably benign
R2400:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2428:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2429:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2431:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R2997:Myg1 UTSW 15 102337510 missense probably null 1.00
R3683:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3827:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R3829:Myg1 UTSW 15 102337736 missense probably damaging 1.00
R4923:Myg1 UTSW 15 102331853 missense probably benign
R5363:Myg1 UTSW 15 102337824 missense probably benign 0.00
R5419:Myg1 UTSW 15 102336962 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAGAATGACTCTACCTACCTTG -3'
(R):5'- GTTGTCAACTGAAAAGCAAAGCAC -3'

Sequencing Primer
(F):5'- GAATGACTCTACCTACCTTGAAGTC -3'
(R):5'- AGCAAAGCACTTACAAGTCTAAG -3'
Posted On2015-04-02