Incidental Mutation 'R3833:Hao1'
ID275451
Institutional Source Beutler Lab
Gene Symbol Hao1
Ensembl Gene ENSMUSG00000027261
Gene Namehydroxyacid oxidase 1, liver
SynonymsGOX, Gox1, Hao-1
MMRRC Submission 040888-MU
Accession Numbers

Genbank: NM_010403; MGI: 96011

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R3833 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location134497361-134554368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134523005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 234 (V234D)
Ref Sequence ENSEMBL: ENSMUSP00000028704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028704]
Predicted Effect probably damaging
Transcript: ENSMUST00000028704
AA Change: V234D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028704
Gene: ENSMUSG00000027261
AA Change: V234D

DomainStartEndE-ValueType
Pfam:FMN_dh 15 362 9.1e-140 PFAM
Meta Mutation Damage Score 0.7201 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
PHENOTYPE: Electrophoretic variants are known for this locus. The a allele determines a fast migrating band in BALB/c, CBA/H, C3H/He and C57BL/6; the b allele, a slow band in NZC; the c allele, the fastest band in DBA/Li, NFS/N, STS, 101/H and 129. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik G A 9: 101,942,863 G161S probably damaging Het
Acp7 T C 7: 28,615,094 D282G probably benign Het
Atp10d T A 5: 72,239,225 C258S possibly damaging Het
Atp6ap1 T C X: 74,297,207 I10T possibly damaging Het
Atp6v0d2 T G 4: 19,922,395 N35H probably damaging Het
Bcat1 T A 6: 145,010,108 D349V probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Ccr1 T C 9: 123,964,287 T69A possibly damaging Het
Cenpe T G 3: 135,222,322 probably benign Het
Cps1 G A 1: 67,139,787 G53R probably damaging Het
Cstb T C 10: 78,427,350 F70L probably benign Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Cyp8b1 C A 9: 121,916,043 Q74H probably benign Het
Dennd2a G A 6: 39,506,717 P403L probably damaging Het
Dennd2a G T 6: 39,506,723 S401Y probably damaging Het
Dnaaf5 T C 5: 139,181,565 V447A possibly damaging Het
Dpp9 A T 17: 56,199,113 F429I possibly damaging Het
Gcn1l1 A T 5: 115,592,132 Q835L probably benign Het
Gm14409 T C 2: 177,265,205 S167G possibly damaging Het
Gtf2b T A 3: 142,771,392 D8E probably benign Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Herc4 A G 10: 63,245,960 I21V probably benign Het
Htt T A 5: 34,821,718 V815D probably benign Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Igsf8 G T 1: 172,318,270 A315S probably benign Het
Il1a T C 2: 129,306,679 D37G possibly damaging Het
Iqcb1 T A 16: 36,831,914 C62* probably null Het
Itgad A T 7: 128,186,233 T381S probably damaging Het
Itpkb T C 1: 180,333,695 V462A probably benign Het
Kalrn T A 16: 34,039,889 R199* probably null Het
Kif24 G T 4: 41,395,064 A603D probably damaging Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klrc3 A G 6: 129,643,218 L24P probably damaging Het
Lmnb1 A C 18: 56,728,526 D163A probably benign Het
Lrrc9 T C 12: 72,482,991 L912P probably damaging Het
Mageh1 A T X: 153,037,008 W111R probably damaging Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Mapt A T 11: 104,287,135 Q38L possibly damaging Het
Med12 C A X: 101,295,892 P2037Q possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Mep1b C T 18: 21,086,239 T150I possibly damaging Het
Mroh1 C T 15: 76,401,619 T71I probably benign Het
Nap1l3 A G X: 122,396,298 V241A possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pgap1 A G 1: 54,557,465 M39T probably damaging Het
Pgc C A 17: 47,729,311 F93L probably null Het
Phf14 A G 6: 11,933,874 probably null Het
Piezo2 A G 18: 63,081,662 probably null Het
Pja2 T C 17: 64,309,402 D166G probably benign Het
Ppp1r12c T A 7: 4,482,786 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rhbdf2 T A 11: 116,604,424 D251V probably damaging Het
Rsad1 A G 11: 94,543,304 V366A probably benign Het
S100a10 T C 3: 93,564,373 V88A probably damaging Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Scn7a A G 2: 66,697,684 S821P probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Sdsl C A 5: 120,463,118 A30S probably benign Het
Slc26a6 C T 9: 108,855,918 T32I possibly damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tdrd3 A G 14: 87,480,785 T201A probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Thsd1 T G 8: 22,243,116 S60A possibly damaging Het
Tmem121b C T 6: 120,492,880 G292E probably damaging Het
Trim63 A G 4: 134,321,196 N172S probably benign Het
Usp24 T C 4: 106,362,012 probably null Het
Wisp3 T C 10: 39,154,949 K193E probably benign Het
Zdhhc16 T A 19: 41,938,114 probably null Het
Zfp709 G A 8: 71,889,062 V112M probably benign Het
Other mutations in Hao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Hao1 APN 2 134554270 missense probably damaging 0.99
IGL00886:Hao1 APN 2 134523159 missense probably benign 0.00
IGL00954:Hao1 APN 2 134498261 missense possibly damaging 0.87
IGL01472:Hao1 APN 2 134554230 missense probably benign 0.04
IGL01570:Hao1 APN 2 134554200 missense probably damaging 0.97
3-1:Hao1 UTSW 2 134500996 critical splice donor site probably null
R0928:Hao1 UTSW 2 134505616 missense possibly damaging 0.54
R0948:Hao1 UTSW 2 134530773 missense probably damaging 1.00
R1204:Hao1 UTSW 2 134523027 nonsense probably null
R1748:Hao1 UTSW 2 134498318 missense possibly damaging 0.67
R1827:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1828:Hao1 UTSW 2 134530664 missense probably benign 0.09
R1917:Hao1 UTSW 2 134523060 missense probably benign 0.02
R2054:Hao1 UTSW 2 134498258 synonymous silent
R2070:Hao1 UTSW 2 134530615 missense probably damaging 1.00
R3831:Hao1 UTSW 2 134523005 missense probably damaging 1.00
R3960:Hao1 UTSW 2 134522983 critical splice donor site probably null
R4509:Hao1 UTSW 2 134523044 missense probably damaging 0.99
R4635:Hao1 UTSW 2 134523152 missense probably damaging 1.00
R4662:Hao1 UTSW 2 134523027 nonsense probably null
R4716:Hao1 UTSW 2 134505620 missense probably damaging 1.00
R6161:Hao1 UTSW 2 134505625 missense probably benign 0.06
R6374:Hao1 UTSW 2 134523104 missense probably benign 0.14
R6799:Hao1 UTSW 2 134530765 missense probably damaging 1.00
R6876:Hao1 UTSW 2 134501149 missense probably benign 0.00
R7305:Hao1 UTSW 2 134548201 missense probably benign 0.00
R7554:Hao1 UTSW 2 134530618 missense possibly damaging 0.78
R7585:Hao1 UTSW 2 134501156 missense probably damaging 1.00
R7920:Hao1 UTSW 2 134548252 missense probably damaging 1.00
R8528:Hao1 UTSW 2 134522993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCACAGTCAAGAGGTTTAC -3'
(R):5'- TGGCTGAGTACGTTACAGAAAG -3'

Sequencing Primer
(F):5'- TATAGTGACTCGCAAGTGCC -3'
(R):5'- TCACCAAGTCAGATATAAACTGTCTC -3'
Posted On2015-04-06