Incidental Mutation 'R3833:Cstb'
ID 275489
Institutional Source Beutler Lab
Gene Symbol Cstb
Ensembl Gene ENSMUSG00000005054
Gene Name cystatin B
Synonyms Stfb
MMRRC Submission 040888-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3833 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 78261504-78263456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78263184 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 70 (F70L)
Ref Sequence ENSEMBL: ENSMUSP00000005185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005185]
AlphaFold Q62426
Predicted Effect probably benign
Transcript: ENSMUST00000005185
AA Change: F70L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000005185
Gene: ENSMUSG00000005054
AA Change: F70L

DomainStartEndE-ValueType
CY 1 98 2.04e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218544
Meta Mutation Damage Score 0.4916 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and kininogens. This gene encodes a stefin that functions as an intracellular thiol protease inhibitor. The protein is able to form a dimer stabilized by noncovalent forces, inhibiting papain and cathepsins l, h and b. The protein is thought to play a role in protecting against the proteases leaking from lysosomes. Evidence indicates that mutations in this gene are responsible for the primary defects in patients with progressive myoclonic epilepsy (EPM1). One type of mutation responsible for EPM1 is the expansion in the promoter region of this gene of a CCCCGCCCCGCG repeat from 2-3 copies to 30-78 copies. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null mutation provide a model for Unverricht-Lundborg disease (EPM1) by displaying progressive ataxia and myoclonic seizures. Notably, homozygous null mice exhibit apoptosis in cerebellar granule cells, implying that a similar mechanism of cell loss may occur in human EPM1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik G A 9: 101,820,062 (GRCm39) G161S probably damaging Het
Acp7 T C 7: 28,314,519 (GRCm39) D282G probably benign Het
Atp10d T A 5: 72,396,568 (GRCm39) C258S possibly damaging Het
Atp6ap1 T C X: 73,340,813 (GRCm39) I10T possibly damaging Het
Atp6v0d2 T G 4: 19,922,395 (GRCm39) N35H probably damaging Het
Bcat1 T A 6: 144,955,834 (GRCm39) D349V probably damaging Het
Cacnb2 A T 2: 14,986,236 (GRCm39) I338F probably damaging Het
Ccn6 T C 10: 39,030,945 (GRCm39) K193E probably benign Het
Ccr1 T C 9: 123,764,324 (GRCm39) T69A possibly damaging Het
Cenpe T G 3: 134,928,083 (GRCm39) probably benign Het
Cps1 G A 1: 67,178,946 (GRCm39) G53R probably damaging Het
Cyb5d2 G T 11: 72,686,349 (GRCm39) S80R possibly damaging Het
Cyfip2 T C 11: 46,152,333 (GRCm39) D485G probably benign Het
Cyp27b1 G T 10: 126,886,929 (GRCm39) V382L probably damaging Het
Cyp8b1 C A 9: 121,745,109 (GRCm39) Q74H probably benign Het
Dennd2a G A 6: 39,483,651 (GRCm39) P403L probably damaging Het
Dennd2a G T 6: 39,483,657 (GRCm39) S401Y probably damaging Het
Dnaaf5 T C 5: 139,167,320 (GRCm39) V447A possibly damaging Het
Dpp9 A T 17: 56,506,113 (GRCm39) F429I possibly damaging Het
Gcn1 A T 5: 115,730,191 (GRCm39) Q835L probably benign Het
Gtf2b T A 3: 142,477,153 (GRCm39) D8E probably benign Het
Hao1 A T 2: 134,364,925 (GRCm39) V234D probably damaging Het
Hephl1 T C 9: 14,981,044 (GRCm39) E796G probably damaging Het
Herc4 A G 10: 63,081,739 (GRCm39) I21V probably benign Het
Htt T A 5: 34,979,062 (GRCm39) V815D probably benign Het
Iglv2 A T 16: 19,079,593 (GRCm39) M1K probably null Het
Igsf8 G T 1: 172,145,837 (GRCm39) A315S probably benign Het
Il1a T C 2: 129,148,599 (GRCm39) D37G possibly damaging Het
Iqcb1 T A 16: 36,652,276 (GRCm39) C62* probably null Het
Itgad A T 7: 127,785,405 (GRCm39) T381S probably damaging Het
Itpkb T C 1: 180,161,260 (GRCm39) V462A probably benign Het
Kalrn T A 16: 33,860,259 (GRCm39) R199* probably null Het
Kif24 G T 4: 41,395,064 (GRCm39) A603D probably damaging Het
Kif26b GAAA GAA 1: 178,744,181 (GRCm39) probably null Het
Klrc3 A G 6: 129,620,181 (GRCm39) L24P probably damaging Het
Lmnb1 A C 18: 56,861,598 (GRCm39) D163A probably benign Het
Lrrc9 T C 12: 72,529,765 (GRCm39) L912P probably damaging Het
Mageh1 A T X: 151,820,004 (GRCm39) W111R probably damaging Het
Mapk7 A G 11: 61,380,680 (GRCm39) S641P possibly damaging Het
Mapt A T 11: 104,177,961 (GRCm39) Q38L possibly damaging Het
Med12 C A X: 100,339,498 (GRCm39) P2037Q possibly damaging Het
Med22 A G 2: 26,800,379 (GRCm39) S17P probably damaging Het
Mep1b C T 18: 21,219,296 (GRCm39) T150I possibly damaging Het
Mroh1 C T 15: 76,285,819 (GRCm39) T71I probably benign Het
Nap1l3 A G X: 121,305,995 (GRCm39) V241A possibly damaging Het
Pcdhga6 A T 18: 37,841,479 (GRCm39) N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 (GRCm39) S278P probably damaging Het
Pgap1 A G 1: 54,596,624 (GRCm39) M39T probably damaging Het
Pgc C A 17: 48,040,236 (GRCm39) F93L probably null Het
Phf14 A G 6: 11,933,873 (GRCm39) probably null Het
Piezo2 A G 18: 63,214,733 (GRCm39) probably null Het
Pja2 T C 17: 64,616,397 (GRCm39) D166G probably benign Het
Ppp1r12c T A 7: 4,485,785 (GRCm39) probably benign Het
Pus3 G C 9: 35,477,874 (GRCm39) G369R probably benign Het
Rhbdf2 T A 11: 116,495,250 (GRCm39) D251V probably damaging Het
Rsad1 A G 11: 94,434,130 (GRCm39) V366A probably benign Het
S100a10 T C 3: 93,471,680 (GRCm39) V88A probably damaging Het
Scarf1 T C 11: 75,406,078 (GRCm39) C121R probably damaging Het
Scn7a A G 2: 66,528,028 (GRCm39) S821P probably damaging Het
Sco1 T C 11: 66,944,605 (GRCm39) V76A probably damaging Het
Sdsl C A 5: 120,601,183 (GRCm39) A30S probably benign Het
Slc26a6 C T 9: 108,733,117 (GRCm39) T32I possibly damaging Het
Slit3 A T 11: 35,579,509 (GRCm39) S1229C probably null Het
Snd1 G T 6: 28,531,403 (GRCm39) probably benign Het
Tdrd3 A G 14: 87,718,221 (GRCm39) T201A probably damaging Het
Tekt1 T C 11: 72,245,645 (GRCm39) N170S probably benign Het
Thsd1 T G 8: 22,733,132 (GRCm39) S60A possibly damaging Het
Tmem121b C T 6: 120,469,841 (GRCm39) G292E probably damaging Het
Trim63 A G 4: 134,048,507 (GRCm39) N172S probably benign Het
Usp24 T C 4: 106,219,209 (GRCm39) probably null Het
Zdhhc16 T A 19: 41,926,553 (GRCm39) probably null Het
Zfp1010 T C 2: 176,956,998 (GRCm39) S167G possibly damaging Het
Zfp709 G A 8: 72,642,906 (GRCm39) V112M probably benign Het
Other mutations in Cstb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Cstb APN 10 78,262,779 (GRCm39) missense probably benign 0.03
R0020:Cstb UTSW 10 78,263,170 (GRCm39) missense probably benign 0.07
R0020:Cstb UTSW 10 78,263,170 (GRCm39) missense probably benign 0.07
R1867:Cstb UTSW 10 78,263,273 (GRCm39) makesense probably null
R7378:Cstb UTSW 10 78,262,822 (GRCm39) missense probably damaging 1.00
R9406:Cstb UTSW 10 78,263,173 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTGCAGAGAACCCCTTAAGG -3'
(R):5'- GAAGCTGCTCAACTCCCTTC -3'

Sequencing Primer
(F):5'- TAGGGTTCCCGGCCTTAAAG -3'
(R):5'- TTCTCTCCATCACCGAGGGG -3'
Posted On 2015-04-06