Incidental Mutation 'R3834:Vmn1r32'
ID275534
Institutional Source Beutler Lab
Gene Symbol Vmn1r32
Ensembl Gene ENSMUSG00000062905
Gene Namevomeronasal 1 receptor 32
SynonymsV1rc15
MMRRC Submission 040889-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R3834 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location66552180-66560096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66553663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 43 (C43F)
Ref Sequence ENSEMBL: ENSMUSP00000153723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079584] [ENSMUST00000227014]
Predicted Effect probably benign
Transcript: ENSMUST00000079584
AA Change: C43F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000078536
Gene: ENSMUSG00000062905
AA Change: C43F

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227014
AA Change: C43F

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adh6a G A 3: 138,327,514 probably null Het
Bptf T C 11: 107,073,857 T1389A probably benign Het
Cfap54 A G 10: 92,801,123 probably benign Het
Coq5 G T 5: 115,284,576 G180W probably damaging Het
Cyp2d34 A G 15: 82,616,746 probably null Het
Cyp2j13 C T 4: 96,056,557 probably null Het
Fam114a1 C T 5: 65,006,073 T197I possibly damaging Het
Fbxo44 A G 4: 148,156,250 Y227H probably damaging Het
Gm5114 T A 7: 39,408,737 H486L possibly damaging Het
Grik4 T C 9: 42,629,123 R254G probably benign Het
Iqcm T C 8: 75,577,752 I47T possibly damaging Het
Kif20b A G 19: 34,935,028 Y278C probably damaging Het
Lbhd1 G A 19: 8,884,057 C43Y probably benign Het
Lrfn5 T A 12: 61,840,030 D201E probably damaging Het
Map1a G A 2: 121,307,322 G2635D probably damaging Het
Ms4a4a A T 19: 11,378,855 M35L probably benign Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Mug2 T C 6: 122,049,787 probably null Het
Nav2 T A 7: 49,545,858 I994N possibly damaging Het
Ngly1 T C 14: 16,290,766 probably benign Het
Nr1i2 T C 16: 38,253,929 probably null Het
Olfr494 A T 7: 108,368,072 D194V probably damaging Het
Olfr561 A G 7: 102,775,286 Y254C probably damaging Het
Olfr651 T A 7: 104,553,345 V142D probably benign Het
Oxct2a C T 4: 123,322,473 V372I probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Pramef17 T A 4: 143,994,226 K48N probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Ptprc T A 1: 138,083,567 N584I probably damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Rps20 A T 4: 3,834,610 I84N probably damaging Het
Scd3 A G 19: 44,241,717 Y313C probably damaging Het
Sertad2 T C 11: 20,648,482 I226T probably benign Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Slco1a1 G T 6: 141,943,437 Q50K possibly damaging Het
Stab2 A T 10: 86,949,912 I622N possibly damaging Het
Tmc4 C T 7: 3,672,007 V222M probably benign Het
Tmem145 T C 7: 25,311,361 F359L probably damaging Het
Tmem238 C A 7: 4,789,079 R155L possibly damaging Het
Vmn2r104 C T 17: 20,029,921 R696K probably benign Het
Other mutations in Vmn1r32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Vmn1r32 APN 6 66552932 missense probably benign
IGL02399:Vmn1r32 APN 6 66552929 missense probably benign 0.18
IGL02964:Vmn1r32 APN 6 66552938 missense probably benign 0.37
IGL03161:Vmn1r32 APN 6 66553220 missense possibly damaging 0.65
IGL03244:Vmn1r32 APN 6 66553505 missense probably damaging 1.00
IGL03248:Vmn1r32 APN 6 66552913 missense possibly damaging 0.82
R0668:Vmn1r32 UTSW 6 66553660 missense possibly damaging 0.90
R0732:Vmn1r32 UTSW 6 66553706 missense probably benign 0.01
R1205:Vmn1r32 UTSW 6 66553555 missense probably benign 0.01
R1638:Vmn1r32 UTSW 6 66552955 missense possibly damaging 0.53
R1732:Vmn1r32 UTSW 6 66553301 missense probably benign 0.19
R2049:Vmn1r32 UTSW 6 66553561 missense probably damaging 1.00
R2127:Vmn1r32 UTSW 6 66553549 missense probably benign 0.09
R3773:Vmn1r32 UTSW 6 66553367 missense probably benign 0.01
R3980:Vmn1r32 UTSW 6 66553714 missense probably damaging 0.98
R4737:Vmn1r32 UTSW 6 66553645 missense probably damaging 1.00
R5569:Vmn1r32 UTSW 6 66553172 missense probably damaging 0.98
R6382:Vmn1r32 UTSW 6 66553361 missense probably benign 0.07
R6894:Vmn1r32 UTSW 6 66553361 missense possibly damaging 0.94
R7394:Vmn1r32 UTSW 6 66553189 missense probably benign 0.06
R7980:Vmn1r32 UTSW 6 66553321 nonsense probably null
R8833:Vmn1r32 UTSW 6 66553639 missense possibly damaging 0.53
R8867:Vmn1r32 UTSW 6 66553667 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGTCACAGCCTGGAACAC -3'
(R):5'- GACAGGGTAATCCAGAATAATTAGC -3'

Sequencing Primer
(F):5'- GCCTGGAACACACTCAGGAG -3'
(R):5'- CAGATGTAAGAATTATGCTTCCTCTG -3'
Posted On2015-04-06