Incidental Mutation 'R3835:Ptprt'
ID275573
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161547387 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1261 (V1261A)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: V1262A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V1262A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: V1261A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V1261A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: V1252A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V1252A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: V1242A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V1242A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.1843 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gm884 C A 11: 103,620,010 L377F unknown Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1428 T A 19: 12,109,400 I49F possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Ovgp1 A G 3: 105,986,315 E468G probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Qtrt2 A G 16: 43,881,072 S42P probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Rpgrip1 A G 14: 52,147,253 E606G probably damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R7813:Ptprt UTSW 2 161530493 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGGGCCATTGTAGAGTCTCC -3'
(R):5'- AATGTGTTCATTATGGGAAGGTCC -3'

Sequencing Primer
(F):5'- GTAGAGTCTCCTTGCAAGTCTATAGC -3'
(R):5'- AAGGTCCCCTTTGCCGC -3'
Posted On2015-04-06