Mutagenetix > Incidental Mutations

Incidental Mutation 'R3835:2610507B11Rik'

275596

Institutional Source

Beutler Lab

Gene Symbol

2610507B11Rik

Ensembl Gene

ENSMUSG00000010277

Gene Name

RIKEN cDNA 2610507B11 gene

Synonyms

D11Bhm178e, D11Bhm179e, E1

MMRRC Submission

040890-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R3835 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78261752-78290623 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 78279085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1545 (R1545G)

Ref Sequence

ENSEMBL: ENSMUSP00000010421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010421]

AlphaFold

Q5SYL3

Predicted Effect

probably benign
Transcript: ENSMUST00000010421
AA Change: R1545G

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: R1545G

Domain	Start	End	E-Value	Type
low complexity region	3	21	N/A	INTRINSIC
Pfam:Fmp27	26	475	1.6e-45	PFAM
Pfam:Fmp27	446	674	3.2e-24	PFAM
low complexity region	719	734	N/A	INTRINSIC
low complexity region	785	798	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
Fmp27_GFWDK	1028	1160	3.01e-61	SMART
low complexity region	1415	1421	N/A	INTRINSIC
low complexity region	1690	1701	N/A	INTRINSIC
Pfam:Apt1	1703	2176	2.4e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127017

Predicted Effect

probably benign
Transcript: ENSMUST00000145145

SMART Domains

Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277

Domain	Start	End	E-Value	Type
Pfam:Fmp27_GFWDK	1	52	1.2e-20	PFAM

Meta Mutation Damage Score

0.2841

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (43/44)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	AC	A	17: 47,433,423		probably benign	Het
Adgrl4	T	C	3: 151,510,617	I479T	probably damaging	Het
Adh6a	G	A	3: 138,327,514		probably null	Het
Anapc7	A	G	5: 122,443,877	T528A	possibly damaging	Het
Ap5b1	A	G	19: 5,568,890	T113A	possibly damaging	Het
Apaf1	G	A	10: 91,059,587	R439C	probably benign	Het
Apoa5	A	T	9: 46,270,580	H318L	probably damaging	Het
Btnl9	T	G	11: 49,180,685	T104P	probably damaging	Het
Dennd5a	T	C	7: 109,934,242	K107R	probably benign	Het
Dthd1	A	T	5: 62,849,785	R610W	probably damaging	Het
Eno1	T	C	4: 150,246,662	S186P	probably benign	Het
Fam208b	T	C	13: 3,575,292	T1553A	probably benign	Het
Gipc2	C	A	3: 152,128,186	V153F	probably damaging	Het
Gm884	C	A	11: 103,620,010	L377F	unknown	Het
Gpt	A	G	15: 76,698,583	Y295C	probably damaging	Het
Kcnh5	T	A	12: 74,898,270	Q735L	probably benign	Het
Lrrc10	A	G	10: 117,045,786	N122D	possibly damaging	Het
Meis2	T	C	2: 115,921,747	H301R	probably damaging	Het
Muc5b	A	T	7: 141,859,181	I1955F	unknown	Het
Nalcn	A	T	14: 123,293,422		probably benign	Het
Nmt2	T	C	2: 3,314,686		probably benign	Het
Nnt	C	T	13: 119,372,495	G403R	probably damaging	Het
Olfr1252	T	G	2: 89,721,455	I219L	possibly damaging	Het
Olfr1428	T	A	19: 12,109,400	I49F	possibly damaging	Het
Olfr1463	A	T	19: 13,234,739	D163V	probably benign	Het
Ovgp1	A	G	3: 105,986,315	E468G	probably benign	Het
Pax6	G	A	2: 105,696,450	E234K	probably benign	Het
Prkdc	A	G	16: 15,791,946	E3138G	probably damaging	Het
Prmt6	T	C	3: 110,250,805	D56G	possibly damaging	Het
Ptprt	A	G	2: 161,547,387	V1261A	probably damaging	Het
Qtrt2	A	G	16: 43,881,072	S42P	probably damaging	Het
Rab9b	C	T	X: 136,861,510	R47Q	possibly damaging	Het
Rpgrip1	A	G	14: 52,147,253	E606G	probably damaging	Het
Setx	C	T	2: 29,145,060	S519L	possibly damaging	Het
Slc15a2	A	T	16: 36,772,128	C191*	probably null	Het
Snrk	T	C	9: 122,137,003		probably benign	Het
St6galnac1	T	C	11: 116,766,283	D422G	probably damaging	Het
Stag1	C	T	9: 100,737,982	T46I	probably damaging	Het
Tagln	T	C	9: 45,931,710	I18V	probably benign	Het
Tbx18	C	A	9: 87,729,636	A114S	probably benign	Het
Ttc16	T	C	2: 32,769,310	D259G	probably damaging	Het
Vldlr	A	G	19: 27,234,814	D76G	probably damaging	Het
Vmn2r24	G	T	6: 123,787,453	D430Y	probably benign	Het
Xlr3a	T	C	X: 73,095,038	E5G	probably damaging	Het

Other mutations in 2610507B11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:2610507B11Rik	APN	11	78269574	missense	possibly damaging	0.55
IGL00497:2610507B11Rik	APN	11	78272933	missense	probably damaging	1.00
IGL00797:2610507B11Rik	APN	11	78273150	missense	probably benign	0.07
IGL01695:2610507B11Rik	APN	11	78265193	missense	probably benign	0.03
IGL02055:2610507B11Rik	APN	11	78286631	missense	probably damaging	1.00
IGL02066:2610507B11Rik	APN	11	78273232	missense	probably damaging	1.00
IGL02231:2610507B11Rik	APN	11	78279896	missense	probably benign
IGL02282:2610507B11Rik	APN	11	78284228	missense	probably benign	0.22
IGL02293:2610507B11Rik	APN	11	78271910	missense	probably damaging	1.00
IGL02336:2610507B11Rik	APN	11	78289032	missense	probably damaging	1.00
IGL02528:2610507B11Rik	APN	11	78271976	missense	possibly damaging	0.93
IGL03231:2610507B11Rik	APN	11	78268702	missense	probably benign	0.02
R0003:2610507B11Rik	UTSW	11	78286578	missense	possibly damaging	0.66
R0197:2610507B11Rik	UTSW	11	78269704	unclassified	probably benign
R0244:2610507B11Rik	UTSW	11	78286491	splice site	probably null
R0281:2610507B11Rik	UTSW	11	78271924	missense	possibly damaging	0.88
R0396:2610507B11Rik	UTSW	11	78268377	missense	possibly damaging	0.93
R0624:2610507B11Rik	UTSW	11	78268457	missense	probably damaging	1.00
R0666:2610507B11Rik	UTSW	11	78287987	missense	probably damaging	1.00
R0666:2610507B11Rik	UTSW	11	78277212	nonsense	probably null
R1313:2610507B11Rik	UTSW	11	78265672	missense	probably benign	0.02
R1313:2610507B11Rik	UTSW	11	78265672	missense	probably benign	0.02
R1443:2610507B11Rik	UTSW	11	78262798	missense	probably damaging	1.00
R1485:2610507B11Rik	UTSW	11	78285580	missense	probably damaging	1.00
R1500:2610507B11Rik	UTSW	11	78284132	missense	possibly damaging	0.46
R1537:2610507B11Rik	UTSW	11	78289343	missense	probably damaging	1.00
R1543:2610507B11Rik	UTSW	11	78275174	missense	probably benign	0.44
R1702:2610507B11Rik	UTSW	11	78289028	missense	probably damaging	1.00
R1804:2610507B11Rik	UTSW	11	78273469	missense	probably damaging	1.00
R1835:2610507B11Rik	UTSW	11	78287750	missense	probably damaging	0.97
R1852:2610507B11Rik	UTSW	11	78268473	missense	probably damaging	1.00
R1861:2610507B11Rik	UTSW	11	78287929	unclassified	probably benign
R1986:2610507B11Rik	UTSW	11	78274612	missense	probably damaging	1.00
R1987:2610507B11Rik	UTSW	11	78268167	missense	probably damaging	1.00
R2061:2610507B11Rik	UTSW	11	78268749	nonsense	probably null
R2113:2610507B11Rik	UTSW	11	78268772	missense	probably benign	0.02
R3692:2610507B11Rik	UTSW	11	78269509	missense	probably damaging	1.00
R3788:2610507B11Rik	UTSW	11	78288297	critical splice donor site	probably null
R3882:2610507B11Rik	UTSW	11	78262700	missense	probably damaging	1.00
R3943:2610507B11Rik	UTSW	11	78269524	nonsense	probably null
R3944:2610507B11Rik	UTSW	11	78269524	nonsense	probably null
R3945:2610507B11Rik	UTSW	11	78289964	missense	probably damaging	1.00
R4196:2610507B11Rik	UTSW	11	78263556	intron	probably benign
R4510:2610507B11Rik	UTSW	11	78277328	missense	possibly damaging	0.59
R4511:2610507B11Rik	UTSW	11	78277328	missense	possibly damaging	0.59
R4756:2610507B11Rik	UTSW	11	78264028	missense	probably damaging	0.98
R5337:2610507B11Rik	UTSW	11	78265208	missense	possibly damaging	0.46
R5419:2610507B11Rik	UTSW	11	78272090	nonsense	probably null
R5572:2610507B11Rik	UTSW	11	78264567	missense	probably damaging	0.98
R5719:2610507B11Rik	UTSW	11	78273245	missense	probably damaging	0.97
R5754:2610507B11Rik	UTSW	11	78269541	missense	probably damaging	1.00
R5890:2610507B11Rik	UTSW	11	78273270	nonsense	probably null
R5919:2610507B11Rik	UTSW	11	78289350	missense	probably damaging	1.00
R5925:2610507B11Rik	UTSW	11	78284238	missense	probably benign	0.06
R5976:2610507B11Rik	UTSW	11	78284129	missense	probably benign	0.00
R5999:2610507B11Rik	UTSW	11	78285468	missense	probably damaging	1.00
R6056:2610507B11Rik	UTSW	11	78271384	missense	possibly damaging	0.77
R6180:2610507B11Rik	UTSW	11	78273258	missense	possibly damaging	0.51
R6484:2610507B11Rik	UTSW	11	78279095	missense	probably damaging	1.00
R6721:2610507B11Rik	UTSW	11	78279799	missense	probably damaging	1.00
R6800:2610507B11Rik	UTSW	11	78288279	missense	probably benign	0.13
R6911:2610507B11Rik	UTSW	11	78268353	missense	probably damaging	0.99
R6923:2610507B11Rik	UTSW	11	78274626	missense	possibly damaging	0.67
R7283:2610507B11Rik	UTSW	11	78274828	missense	probably damaging	1.00
R7287:2610507B11Rik	UTSW	11	78272883	missense	possibly damaging	0.61
R7339:2610507B11Rik	UTSW	11	78272384	critical splice donor site	probably null
R7409:2610507B11Rik	UTSW	11	78268757	missense	probably damaging	1.00
R7473:2610507B11Rik	UTSW	11	78267115	missense	possibly damaging	0.86
R7704:2610507B11Rik	UTSW	11	78268744	missense	probably benign	0.29
R7793:2610507B11Rik	UTSW	11	78273205	missense	possibly damaging	0.56
R8051:2610507B11Rik	UTSW	11	78273412	intron	probably benign
R8186:2610507B11Rik	UTSW	11	78286631	missense	probably damaging	1.00
R8256:2610507B11Rik	UTSW	11	78277153	missense	probably benign	0.00
R8518:2610507B11Rik	UTSW	11	78265238	missense	possibly damaging	0.95
R8677:2610507B11Rik	UTSW	11	78284156	missense	probably damaging	1.00
R8736:2610507B11Rik	UTSW	11	78288049	missense	probably benign	0.26
R8829:2610507B11Rik	UTSW	11	78267238	missense	probably benign	0.02
R8832:2610507B11Rik	UTSW	11	78267238	missense	probably benign	0.02
R9006:2610507B11Rik	UTSW	11	78273519	missense	possibly damaging	0.90
R9014:2610507B11Rik	UTSW	11	78269662	missense	possibly damaging	0.78
R9184:2610507B11Rik	UTSW	11	78271388	missense	probably damaging	1.00
R9473:2610507B11Rik	UTSW	11	78284157	missense	probably damaging	1.00
X0028:2610507B11Rik	UTSW	11	78286635	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCCGTGTTCCAGGTTGAAG -3'
(R):5'- ACCCATTCTTCAGTTATACGTGG -3'

Sequencing Primer
(F):5'- CCAGGTTGAAGATGTAGCTCAGTCC -3'
(R):5'- CCAAGAGCCTTCCTTGGGTTAAAG -3'

Posted On

2015-04-06