Incidental Mutation 'R3835:Gm884'
ID275597
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103620010 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 377 (L377F)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279]
Predicted Effect unknown
Transcript: ENSMUST00000059279
AA Change: L377F
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: L377F

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1428 T A 19: 12,109,400 I49F possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Ovgp1 A G 3: 105,986,315 E468G probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Qtrt2 A G 16: 43,881,072 S42P probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Rpgrip1 A G 14: 52,147,253 E606G probably damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGCTGGCTTTCAAATTGACTC -3'
(R):5'- AACTTTCTGAGTCTCCTGAGGTG -3'

Sequencing Primer
(F):5'- TCCCCAGGAGTCTCAGAAGTCTG -3'
(R):5'- TGGTAGGATCCGATTCTGAAAACC -3'
Posted On2015-04-06