Incidental Mutation 'R3835:Rpgrip1'
ID275602
Institutional Source Beutler Lab
Gene Symbol Rpgrip1
Ensembl Gene ENSMUSG00000057132
Gene Nameretinitis pigmentosa GTPase regulator interacting protein 1
SynonymsA930002K18Rik, 4930505G06Rik, 4930401L23Rik, nmf247
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52110704-52163546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52147253 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 606 (E606G)
Ref Sequence ENSEMBL: ENSMUSP00000107227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111600] [ENSMUST00000111603] [ENSMUST00000180646] [ENSMUST00000181017] [ENSMUST00000181401]
Predicted Effect probably damaging
Transcript: ENSMUST00000111600
AA Change: E606G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107227
Gene: ENSMUSG00000057132
AA Change: E606G

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 542 N/A INTRINSIC
C2 602 707 1.08e-2 SMART
coiled coil region 746 795 N/A INTRINSIC
Blast:C2 958 1086 1e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111603
AA Change: E768G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107230
Gene: ENSMUSG00000057132
AA Change: E768G

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 543 N/A INTRINSIC
Pfam:C2-C2_1 582 721 1.9e-49 PFAM
C2 764 869 7.3e-5 SMART
coiled coil region 910 999 N/A INTRINSIC
Blast:C2 1162 1290 2e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180388
Predicted Effect probably benign
Transcript: ENSMUST00000180500
Predicted Effect probably benign
Transcript: ENSMUST00000180513
Predicted Effect probably benign
Transcript: ENSMUST00000180646
SMART Domains Protein: ENSMUSP00000137751
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180901
SMART Domains Protein: ENSMUSP00000137826
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 179 223 N/A INTRINSIC
coiled coil region 274 363 N/A INTRINSIC
Blast:C2 526 654 2e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181017
SMART Domains Protein: ENSMUSP00000137900
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Blast:C2 126 254 2e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181297
SMART Domains Protein: ENSMUSP00000137653
Gene: ENSMUSG00000057132

DomainStartEndE-ValueType
coiled coil region 180 224 N/A INTRINSIC
low complexity region 257 284 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000181401
AA Change: E757G
SMART Domains Protein: ENSMUSP00000138027
Gene: ENSMUSG00000057132
AA Change: E757G

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
coiled coil region 248 348 N/A INTRINSIC
coiled coil region 499 547 N/A INTRINSIC
Pfam:DUF3250 605 710 2.8e-46 PFAM
C2 753 858 1.08e-2 SMART
coiled coil region 899 988 N/A INTRINSIC
Blast:C2 1151 1279 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000181627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181862
Meta Mutation Damage Score 0.2087 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a photoreceptor protein that interacts with retinitis pigmentosa GTPase regulator protein and is a key component of cone and rod photoreceptor cells. Mutations in this gene lead to autosomal recessive congenital blindness. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene results in photoreceptor cell dysmorphology. By 3 months of age mutant animals show near complete loss of photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gm884 C A 11: 103,620,010 L377F unknown Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1428 T A 19: 12,109,400 I49F possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Ovgp1 A G 3: 105,986,315 E468G probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Qtrt2 A G 16: 43,881,072 S42P probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Rpgrip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Rpgrip1 APN 14 52150438 unclassified probably null
IGL01016:Rpgrip1 APN 14 52145836 missense probably damaging 1.00
IGL01019:Rpgrip1 APN 14 52131176 missense possibly damaging 0.70
IGL01382:Rpgrip1 APN 14 52145477 missense possibly damaging 0.93
IGL01433:Rpgrip1 APN 14 52126377 missense probably damaging 1.00
IGL01528:Rpgrip1 APN 14 52112177 nonsense probably null
IGL01548:Rpgrip1 APN 14 52126271 splice site probably benign
IGL01652:Rpgrip1 APN 14 52145492 unclassified probably benign
IGL02040:Rpgrip1 APN 14 52121019 missense possibly damaging 0.86
IGL02113:Rpgrip1 APN 14 52133844 missense possibly damaging 0.85
IGL02121:Rpgrip1 APN 14 52147374 missense possibly damaging 0.89
IGL02185:Rpgrip1 APN 14 52112228 missense possibly damaging 0.72
IGL02234:Rpgrip1 APN 14 52131309 splice site probably benign
IGL02322:Rpgrip1 APN 14 52150042 missense possibly damaging 0.89
IGL02379:Rpgrip1 APN 14 52138888 missense possibly damaging 0.53
IGL02524:Rpgrip1 APN 14 52121054 missense probably benign 0.01
IGL02836:Rpgrip1 APN 14 52145257 unclassified probably null
IGL03264:Rpgrip1 APN 14 52140652 missense possibly damaging 0.53
IGL03410:Rpgrip1 APN 14 52158366 unclassified probably benign
FR4976:Rpgrip1 UTSW 14 52149394 utr 3 prime probably benign
FR4976:Rpgrip1 UTSW 14 52149544 utr 3 prime probably benign
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0045:Rpgrip1 UTSW 14 52141144 missense possibly damaging 0.53
R0089:Rpgrip1 UTSW 14 52149384 utr 3 prime probably benign
R0498:Rpgrip1 UTSW 14 52131314 splice site probably benign
R0602:Rpgrip1 UTSW 14 52133856 missense possibly damaging 0.72
R0776:Rpgrip1 UTSW 14 52141169 missense possibly damaging 0.85
R1139:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
R1528:Rpgrip1 UTSW 14 52112224 missense probably benign 0.01
R1715:Rpgrip1 UTSW 14 52140691 missense possibly damaging 0.53
R1934:Rpgrip1 UTSW 14 52114644 missense possibly damaging 0.53
R2087:Rpgrip1 UTSW 14 52136622 intron probably null
R2114:Rpgrip1 UTSW 14 52149567 missense probably benign 0.27
R3406:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R4084:Rpgrip1 UTSW 14 52149351 missense possibly damaging 0.72
R4124:Rpgrip1 UTSW 14 52152324 splice site probably null
R4381:Rpgrip1 UTSW 14 52150449 missense possibly damaging 0.54
R4407:Rpgrip1 UTSW 14 52147399 missense probably damaging 1.00
R4520:Rpgrip1 UTSW 14 52152289 missense probably benign 0.08
R4904:Rpgrip1 UTSW 14 52121087 missense possibly damaging 0.86
R4904:Rpgrip1 UTSW 14 52160129 missense probably damaging 0.97
R5284:Rpgrip1 UTSW 14 52149276 missense probably damaging 1.00
R5342:Rpgrip1 UTSW 14 52145209 missense possibly damaging 0.92
R5377:Rpgrip1 UTSW 14 52160195 missense possibly damaging 0.96
R5499:Rpgrip1 UTSW 14 52140585 missense probably benign 0.00
R5729:Rpgrip1 UTSW 14 52160160 missense probably benign 0.28
R5834:Rpgrip1 UTSW 14 52158382 missense probably damaging 0.99
R6157:Rpgrip1 UTSW 14 52112174 missense probably benign 0.00
R6455:Rpgrip1 UTSW 14 52141189 missense probably damaging 0.97
R6796:Rpgrip1 UTSW 14 52150012 missense probably damaging 1.00
R7065:Rpgrip1 UTSW 14 52141193 missense possibly damaging 0.96
R7173:Rpgrip1 UTSW 14 52112176 missense possibly damaging 0.59
R7302:Rpgrip1 UTSW 14 52149555 missense unknown
R7315:Rpgrip1 UTSW 14 52121001 missense not run
R7320:Rpgrip1 UTSW 14 52131216 missense possibly damaging 0.53
R7344:Rpgrip1 UTSW 14 52140659 missense probably damaging 0.98
R7459:Rpgrip1 UTSW 14 52140559 missense probably benign 0.18
R7797:Rpgrip1 UTSW 14 52133820 missense possibly damaging 0.53
R7852:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R7935:Rpgrip1 UTSW 14 52145880 missense probably benign 0.01
R8041:Rpgrip1 UTSW 14 52119245 missense possibly damaging 0.53
RF005:Rpgrip1 UTSW 14 52149391 utr 3 prime probably benign
RF028:Rpgrip1 UTSW 14 52149398 nonsense probably null
RF034:Rpgrip1 UTSW 14 52149526 utr 3 prime probably benign
RF035:Rpgrip1 UTSW 14 52149393 utr 3 prime probably benign
RF036:Rpgrip1 UTSW 14 52149541 frame shift probably null
RF040:Rpgrip1 UTSW 14 52149537 frame shift probably null
RF043:Rpgrip1 UTSW 14 52149395 utr 3 prime probably benign
X0024:Rpgrip1 UTSW 14 52141208 missense possibly damaging 0.85
X0026:Rpgrip1 UTSW 14 52147221 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTTAGGCATCCTCATGACCTGG -3'
(R):5'- GGCTCTGGGTCTTCATCATC -3'

Sequencing Primer
(F):5'- ATCCTCATGACCTGGCAGAGTAG -3'
(R):5'- TCAGATACTGGTCCAGGTCAG -3'
Posted On2015-04-06