Incidental Mutation 'R3835:Qtrt2'
ID275607
Institutional Source Beutler Lab
Gene Symbol Qtrt2
Ensembl Gene ENSMUSG00000022704
Gene Namequeuine tRNA-ribosyltransferase accessory subunit 2
Synonyms3110012M05Rik, 4930470H18Rik
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location43861407-43926809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43881072 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 42 (S42P)
Ref Sequence ENSEMBL: ENSMUSP00000115274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023387] [ENSMUST00000134792]
Predicted Effect probably benign
Transcript: ENSMUST00000023387
AA Change: S42P

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023387
Gene: ENSMUSG00000022704
AA Change: S42P

DomainStartEndE-ValueType
Pfam:TGT 95 340 7.1e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131360
Predicted Effect probably damaging
Transcript: ENSMUST00000134792
AA Change: S42P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115274
Gene: ENSMUSG00000022704
AA Change: S42P

DomainStartEndE-ValueType
SCOP:d1k4ga_ 2 67 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156568
Meta Mutation Damage Score 0.4453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gm884 C A 11: 103,620,010 L377F unknown Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1428 T A 19: 12,109,400 I49F possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Ovgp1 A G 3: 105,986,315 E468G probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Rpgrip1 A G 14: 52,147,253 E606G probably damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Qtrt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Qtrt2 APN 16 43881189 missense probably damaging 0.99
R1018:Qtrt2 UTSW 16 43878000 missense possibly damaging 0.93
R1258:Qtrt2 UTSW 16 43869083 missense possibly damaging 0.77
R1499:Qtrt2 UTSW 16 43868974 missense probably benign 0.43
R1574:Qtrt2 UTSW 16 43871832 unclassified probably benign
R1830:Qtrt2 UTSW 16 43871655 missense probably damaging 1.00
R2013:Qtrt2 UTSW 16 43869092 missense probably damaging 1.00
R5199:Qtrt2 UTSW 16 43867425 missense probably benign 0.10
R7449:Qtrt2 UTSW 16 43881032 missense probably benign 0.06
R7621:Qtrt2 UTSW 16 43868940 splice site probably null
R8143:Qtrt2 UTSW 16 43871754 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGGTCTCGCTGGGATC -3'
(R):5'- TAGATGTCACGAATCACCTTCTAAC -3'

Sequencing Primer
(F):5'- TGGGATCCAGGTTAGGACC -3'
(R):5'- CACGAATCACCTTCTAACTTTAATGC -3'
Posted On2015-04-06