Incidental Mutation 'R3835:Olfr1428'
ID275610
Institutional Source Beutler Lab
Gene Symbol Olfr1428
Ensembl Gene ENSMUSG00000067524
Gene Nameolfactory receptor 1428
SynonymsGA_x6K02T2RE5P-2468394-2467450, MOR239-5
MMRRC Submission 040890-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3835 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12107716-12115897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12109400 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 49 (I49F)
Ref Sequence ENSEMBL: ENSMUSP00000150097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087824] [ENSMUST00000208391] [ENSMUST00000214103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087824
AA Change: I49F

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085126
Gene: ENSMUSG00000067524
AA Change: I49F

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.2e-6 PFAM
Pfam:7tm_1 41 303 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208391
Predicted Effect possibly damaging
Transcript: ENSMUST00000214103
AA Change: I49F

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
2610507B11Rik A G 11: 78,279,085 R1545G probably benign Het
Adgrl4 T C 3: 151,510,617 I479T probably damaging Het
Adh6a G A 3: 138,327,514 probably null Het
Anapc7 A G 5: 122,443,877 T528A possibly damaging Het
Ap5b1 A G 19: 5,568,890 T113A possibly damaging Het
Apaf1 G A 10: 91,059,587 R439C probably benign Het
Apoa5 A T 9: 46,270,580 H318L probably damaging Het
Btnl9 T G 11: 49,180,685 T104P probably damaging Het
Dennd5a T C 7: 109,934,242 K107R probably benign Het
Dthd1 A T 5: 62,849,785 R610W probably damaging Het
Eno1 T C 4: 150,246,662 S186P probably benign Het
Fam208b T C 13: 3,575,292 T1553A probably benign Het
Gipc2 C A 3: 152,128,186 V153F probably damaging Het
Gm884 C A 11: 103,620,010 L377F unknown Het
Gpt A G 15: 76,698,583 Y295C probably damaging Het
Kcnh5 T A 12: 74,898,270 Q735L probably benign Het
Lrrc10 A G 10: 117,045,786 N122D possibly damaging Het
Meis2 T C 2: 115,921,747 H301R probably damaging Het
Muc5b A T 7: 141,859,181 I1955F unknown Het
Nalcn A T 14: 123,293,422 probably benign Het
Nmt2 T C 2: 3,314,686 probably benign Het
Nnt C T 13: 119,372,495 G403R probably damaging Het
Olfr1252 T G 2: 89,721,455 I219L possibly damaging Het
Olfr1463 A T 19: 13,234,739 D163V probably benign Het
Ovgp1 A G 3: 105,986,315 E468G probably benign Het
Pax6 G A 2: 105,696,450 E234K probably benign Het
Prkdc A G 16: 15,791,946 E3138G probably damaging Het
Prmt6 T C 3: 110,250,805 D56G possibly damaging Het
Ptprt A G 2: 161,547,387 V1261A probably damaging Het
Qtrt2 A G 16: 43,881,072 S42P probably damaging Het
Rab9b C T X: 136,861,510 R47Q possibly damaging Het
Rpgrip1 A G 14: 52,147,253 E606G probably damaging Het
Setx C T 2: 29,145,060 S519L possibly damaging Het
Slc15a2 A T 16: 36,772,128 C191* probably null Het
Snrk T C 9: 122,137,003 probably benign Het
St6galnac1 T C 11: 116,766,283 D422G probably damaging Het
Stag1 C T 9: 100,737,982 T46I probably damaging Het
Tagln T C 9: 45,931,710 I18V probably benign Het
Tbx18 C A 9: 87,729,636 A114S probably benign Het
Ttc16 T C 2: 32,769,310 D259G probably damaging Het
Vldlr A G 19: 27,234,814 D76G probably damaging Het
Vmn2r24 G T 6: 123,787,453 D430Y probably benign Het
Xlr3a T C X: 73,095,038 E5G probably damaging Het
Other mutations in Olfr1428
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03062:Olfr1428 APN 19 12109148 missense probably benign 0.00
IGL02796:Olfr1428 UTSW 19 12108884 missense possibly damaging 0.85
PIT4495001:Olfr1428 UTSW 19 12108712 missense possibly damaging 0.65
R0541:Olfr1428 UTSW 19 12109520 missense possibly damaging 0.85
R1169:Olfr1428 UTSW 19 12109489 missense probably benign
R1918:Olfr1428 UTSW 19 12109507 missense probably benign 0.06
R2915:Olfr1428 UTSW 19 12108625 missense probably benign 0.09
R4470:Olfr1428 UTSW 19 12109183 intron probably null
R4682:Olfr1428 UTSW 19 12108685 missense probably damaging 1.00
R4751:Olfr1428 UTSW 19 12109177 missense probably damaging 1.00
R5467:Olfr1428 UTSW 19 12108659 missense probably benign 0.20
R5513:Olfr1428 UTSW 19 12109381 missense probably damaging 1.00
R6915:Olfr1428 UTSW 19 12109126 missense probably benign 0.25
R7385:Olfr1428 UTSW 19 12108697 missense probably damaging 1.00
R7569:Olfr1428 UTSW 19 12109021 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CATAGGCCATCACAGAGAGG -3'
(R):5'- TCTCCTCCCTAGGTAGATGTGAC -3'

Sequencing Primer
(F):5'- TATCTGCCCCACCAGCAAAGTG -3'
(R):5'- TCCTCCCTAGGTAGATGTGACAGAAG -3'
Posted On2015-04-06