Mutagenetix > Incidental Mutation

Incidental Mutation 'R3836:Ankrd6'

275627

Institutional Source

Beutler Lab

Gene Symbol

Ankrd6

Ensembl Gene

ENSMUSG00000040183

Gene Name

ankyrin repeat domain 6

Synonyms

diversin

MMRRC Submission

040891-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32804035-32950841 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32817531 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 271 (D271V)

Ref Sequence

ENSEMBL: ENSMUSP00000081800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]

AlphaFold

Q69ZU8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035719
AA Change: D306V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: D306V

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084748
AA Change: D271V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: D271V

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	269	2.11e2	SMART
low complexity region	330	342	N/A	INTRINSIC
coiled coil region	382	410	N/A	INTRINSIC
low complexity region	501	521	N/A	INTRINSIC
low complexity region	590	608	N/A	INTRINSIC
coiled coil region	637	677	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084749
AA Change: D306V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: D306V

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084750
AA Change: D306V

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: D306V

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	5.24e-4	SMART
ANK	140	169	3.74e0	SMART
ANK	173	202	6.12e-5	SMART
ANK	206	235	5.32e-5	SMART
ANK	239	268	6.24e2	SMART
low complexity region	365	377	N/A	INTRINSIC
coiled coil region	417	445	N/A	INTRINSIC
low complexity region	536	556	N/A	INTRINSIC
low complexity region	625	643	N/A	INTRINSIC
coiled coil region	672	712	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108166
AA Change: D247V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: D247V

Domain	Start	End	E-Value	Type
ANK	9	38	2.55e2	SMART
ANK	41	70	2.08e-7	SMART
ANK	74	103	3.49e0	SMART
ANK	107	136	3.74e0	SMART
ANK	140	169	6.12e-5	SMART
ANK	173	202	5.32e-5	SMART
low complexity region	207	227	N/A	INTRINSIC
low complexity region	306	318	N/A	INTRINSIC
coiled coil region	358	386	N/A	INTRINSIC
low complexity region	468	491	N/A	INTRINSIC
low complexity region	561	579	N/A	INTRINSIC
coiled coil region	608	648	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140837

Meta Mutation Damage Score

0.1941

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028I16Rik	A	G	10: 82,812,385		noncoding transcript	Het
Aasdh	A	G	5: 76,878,468	V903A	probably benign	Het
Ano10	C	T	9: 122,263,763	V167M	possibly damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
AW551984	T	C	9: 39,597,908		probably benign	Het
Bub1	G	T	2: 127,814,886	P442Q	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Comp	A	G	8: 70,373,859	D28G	probably benign	Het
Crym	A	G	7: 120,201,216	V61A	probably benign	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Dtna	A	T	18: 23,625,102	Q488L	probably damaging	Het
Ecel1	A	C	1: 87,150,656	L565R	probably damaging	Het
Extl2	T	C	3: 116,024,357	I106T	probably benign	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fnbp4	A	G	2: 90,746,785	T154A	probably damaging	Het
Fsip2	T	C	2: 82,950,946	L32P	probably damaging	Het
Gldc	T	A	19: 30,118,675		probably benign	Het
Gm12695	T	G	4: 96,762,097	T171P	probably damaging	Het
Gm4868	A	C	5: 125,847,950		noncoding transcript	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Gstm5	T	C	3: 107,896,362	I37T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itga11	G	T	9: 62,769,283	V918L	probably benign	Het
Itgb2l	T	A	16: 96,426,167	M559L	probably benign	Het
Itih1	T	A	14: 30,935,828	N429Y	probably damaging	Het
Madd	A	T	2: 91,154,643		probably null	Het
Map3k11	A	G	19: 5,690,803	E186G	possibly damaging	Het
Mbl2	T	C	19: 30,239,514	F242S	probably damaging	Het
Mcph1	A	G	8: 18,622,659	T102A	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mkln1	A	G	6: 31,468,336	D389G	probably damaging	Het
Mmrn1	G	A	6: 60,944,847	S96N	probably benign	Het
Myd88	A	G	9: 119,338,193		probably benign	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nprl3	C	T	11: 32,233,082	E502K	probably damaging	Het
Nudt5	T	A	2: 5,866,347		probably null	Het
Olfr1045	A	G	2: 86,198,662	V30A	probably benign	Het
Olfr191	A	G	16: 59,086,223	S87P	possibly damaging	Het
Olfr691	G	A	7: 105,337,210	P169S	probably benign	Het
Olfr810	C	T	10: 129,791,170	V140M	probably benign	Het
Plaa	T	C	4: 94,586,922		probably null	Het
Ptk2b	A	G	14: 66,156,342	L894P	probably damaging	Het
Rab8b	A	G	9: 66,847,796	S183P	probably benign	Het
Reln	A	G	5: 21,911,014	Y2999H	probably damaging	Het
Rims4	A	G	2: 163,918,653	S11P	possibly damaging	Het
Scel	A	G	14: 103,592,386	K448R	possibly damaging	Het
Serpinb10	A	T	1: 107,536,086	T33S	probably benign	Het
Sgip1	A	G	4: 102,867,700		probably null	Het
Spata5	T	A	3: 37,433,643	Y428N	possibly damaging	Het
Sv2b	A	T	7: 75,157,428	M158K	probably damaging	Het
Tmem132d	A	T	5: 127,784,885	I724N	probably damaging	Het
Tnrc6c	A	G	11: 117,723,229	T738A	probably benign	Het
Tpbg	T	C	9: 85,843,114		probably benign	Het
Tubb2a	G	T	13: 34,075,311	N165K	probably benign	Het
Ubtfl1	A	T	9: 18,409,237	E20D	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r25	C	A	6: 123,853,085	D36Y	probably damaging	Het
Wdhd1	A	G	14: 47,245,054	V946A	probably benign	Het
Wnk1	T	C	6: 119,950,043	E1265G	probably damaging	Het
Zmynd8	G	A	2: 165,858,099	T14I	probably benign	Het

Other mutations in Ankrd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02489:Ankrd6	APN	4	32810298	missense	probably damaging	1.00
IGL03247:Ankrd6	APN	4	32860441	start codon destroyed	possibly damaging	0.76
IGL03382:Ankrd6	APN	4	32808771	missense	probably damaging	1.00
R0360:Ankrd6	UTSW	4	32836424	missense	probably damaging	1.00
R0711:Ankrd6	UTSW	4	32815326	missense	probably damaging	1.00
R1074:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1075:Ankrd6	UTSW	4	32822232	missense	probably damaging	1.00
R1498:Ankrd6	UTSW	4	32810289	missense	probably benign	0.17
R1719:Ankrd6	UTSW	4	32828774	missense	probably damaging	1.00
R1823:Ankrd6	UTSW	4	32824427	missense	probably damaging	1.00
R2889:Ankrd6	UTSW	4	32818704	missense	probably damaging	0.99
R2897:Ankrd6	UTSW	4	32860438	missense	probably damaging	0.98
R3815:Ankrd6	UTSW	4	32806206	missense	probably benign	0.39
R4127:Ankrd6	UTSW	4	32822241	missense	probably damaging	1.00
R4994:Ankrd6	UTSW	4	32860387	missense	probably damaging	0.99
R5250:Ankrd6	UTSW	4	32860335	missense	probably damaging	1.00
R5291:Ankrd6	UTSW	4	32823446	missense	probably damaging	1.00
R5335:Ankrd6	UTSW	4	32818651	missense	probably damaging	1.00
R5948:Ankrd6	UTSW	4	32817075	missense	possibly damaging	0.91
R6336:Ankrd6	UTSW	4	32860411	missense	probably damaging	1.00
R6345:Ankrd6	UTSW	4	32810266	missense	probably damaging	1.00
R6349:Ankrd6	UTSW	4	32822231	missense	probably damaging	1.00
R6516:Ankrd6	UTSW	4	32836427	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806419	missense	probably damaging	1.00
R6902:Ankrd6	UTSW	4	32806420	missense	probably damaging	1.00
R6999:Ankrd6	UTSW	4	32823459	missense	probably benign
R7044:Ankrd6	UTSW	4	32815260	missense	possibly damaging	0.93
R7307:Ankrd6	UTSW	4	32816949	missense	possibly damaging	0.92
R7394:Ankrd6	UTSW	4	32821298	missense	probably damaging	0.99
R7496:Ankrd6	UTSW	4	32810299	missense	probably damaging	0.99
R7662:Ankrd6	UTSW	4	32818694	missense	probably damaging	1.00
R7873:Ankrd6	UTSW	4	32806499	missense	possibly damaging	0.91
R8328:Ankrd6	UTSW	4	32810215	missense	probably benign	0.27
R8739:Ankrd6	UTSW	4	32806337	missense	possibly damaging	0.47
R8937:Ankrd6	UTSW	4	32823452	missense	possibly damaging	0.95
R9211:Ankrd6	UTSW	4	32806580	missense	probably damaging	1.00
R9295:Ankrd6	UTSW	4	32822160	missense	probably damaging	0.98
R9319:Ankrd6	UTSW	4	32806324	missense	probably benign	0.02
R9702:Ankrd6	UTSW	4	32810202	missense	possibly damaging	0.49
R9741:Ankrd6	UTSW	4	32860339	nonsense	probably null
X0064:Ankrd6	UTSW	4	32806435	missense	possibly damaging	0.93
Z1176:Ankrd6	UTSW	4	32806229	missense	possibly damaging	0.86
Z1176:Ankrd6	UTSW	4	32806326	missense	probably benign	0.08
Z1176:Ankrd6	UTSW	4	32824486	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGCCTGTTCCCAAACAACC -3'
(R):5'- AGAGCATGCTTCACTTCCTACC -3'

Sequencing Primer
(F):5'- AGTCACCCTAGACCCTCCTG -3'
(R):5'- TGCTTCACTTCCTACCAATAAAAG -3'

Posted On

2015-04-06