Incidental Mutation 'R3836:Tmem132d'
ID275635
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Nametransmembrane protein 132D
Synonyms
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location127781630-128433077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127784885 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 724 (I724N)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
Predicted Effect probably damaging
Transcript: ENSMUST00000044441
AA Change: I724N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: I724N

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127784832 missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127784638 missense probably benign 0.31
IGL01482:Tmem132d APN 5 128269206 missense probably damaging 0.96
IGL01785:Tmem132d APN 5 127984315 missense probably benign 0.00
IGL02409:Tmem132d APN 5 127784888 missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127783979 missense probably benign 0.01
IGL03411:Tmem132d APN 5 127984283 nonsense probably null
R0113:Tmem132d UTSW 5 127784593 missense probably benign 0.11
R0420:Tmem132d UTSW 5 127864646 missense probably benign 0.26
R0437:Tmem132d UTSW 5 127789785 missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128269203 missense probably damaging 1.00
R0564:Tmem132d UTSW 5 127784778 missense probably damaging 1.00
R0659:Tmem132d UTSW 5 127984287 missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 127984439 splice site probably benign
R1209:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127784859 missense probably benign
R1378:Tmem132d UTSW 5 128268947 missense probably benign 0.43
R1741:Tmem132d UTSW 5 127784858 missense probably benign 0.30
R1753:Tmem132d UTSW 5 127789855 missense probably benign 0.02
R1944:Tmem132d UTSW 5 127783764 makesense probably null
R1974:Tmem132d UTSW 5 128269199 missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127792458 missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127784441 missense probably benign
R2074:Tmem132d UTSW 5 128269131 missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127795923 missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128268544 missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127864599 missense probably benign 0.09
R2902:Tmem132d UTSW 5 127783768 missense probably benign
R3053:Tmem132d UTSW 5 127792474 missense probably benign 0.15
R4127:Tmem132d UTSW 5 128268820 missense probably benign 0.35
R4236:Tmem132d UTSW 5 128432325 missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 127984341 missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 127984296 missense probably benign 0.29
R4686:Tmem132d UTSW 5 127792610 missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 127984264 missense probably benign 0.01
R4883:Tmem132d UTSW 5 128269300 missense probably damaging 0.99
R4883:Tmem132d UTSW 5 128269302 missense possibly damaging 0.79
R4939:Tmem132d UTSW 5 127796075 missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127796000 missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127784795 missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127784900 missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128269272 missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127784598 missense probably benign 0.13
R6048:Tmem132d UTSW 5 128269117 missense probably benign 0.03
R6057:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R6084:Tmem132d UTSW 5 127784100 missense probably benign 0.06
R6505:Tmem132d UTSW 5 127784438 missense probably benign 0.00
R6522:Tmem132d UTSW 5 127783768 missense probably benign
R6540:Tmem132d UTSW 5 128268532 missense possibly damaging 0.87
R6717:Tmem132d UTSW 5 127784421 missense probably benign
R7158:Tmem132d UTSW 5 128137019 missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 127984351 missense probably damaging 0.96
R7526:Tmem132d UTSW 5 127784141 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTTTGCATCATTCTGTCC -3'
(R):5'- TCGACACATTGACCCACTTC -3'

Sequencing Primer
(F):5'- GTCCAAATTTAACCTTGATGCTGGC -3'
(R):5'- GACACATTGACCCACTTCTCTTG -3'
Posted On2015-04-06