Incidental Mutation 'R3836:Ubtfl1'
ID275645
Institutional Source Beutler Lab
Gene Symbol Ubtfl1
Ensembl Gene ENSMUSG00000074502
Gene Nameupstream binding transcription factor, RNA polymerase I-like 1
SynonymsHmgpi, B020006M18Rik
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location18404418-18413177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18409237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 20 (E20D)
Ref Sequence ENSEMBL: ENSMUSP00000126540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098973] [ENSMUST00000164441] [ENSMUST00000169398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098973
AA Change: E20D

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096572
Gene: ENSMUSG00000074502
AA Change: E20D

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164441
AA Change: E20D

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129611
Gene: ENSMUSG00000074502
AA Change: E20D

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169398
AA Change: E20D

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126540
Gene: ENSMUSG00000074502
AA Change: E20D

DomainStartEndE-ValueType
Blast:SANT 6 64 1e-17 BLAST
HMG 100 170 5.61e-16 SMART
HMG 224 292 3.79e-4 SMART
low complexity region 297 307 N/A INTRINSIC
low complexity region 373 394 N/A INTRINSIC
Meta Mutation Damage Score 0.0496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Ubtfl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Ubtfl1 APN 9 18409721 missense possibly damaging 0.93
IGL02028:Ubtfl1 APN 9 18409553 missense possibly damaging 0.83
R0112:Ubtfl1 UTSW 9 18409787 missense probably benign 0.24
R0600:Ubtfl1 UTSW 9 18409364 missense probably damaging 1.00
R1450:Ubtfl1 UTSW 9 18409913 missense possibly damaging 0.54
R1511:Ubtfl1 UTSW 9 18410193 missense probably benign 0.00
R2007:Ubtfl1 UTSW 9 18409251 missense possibly damaging 0.93
R3611:Ubtfl1 UTSW 9 18409365 missense probably damaging 1.00
R4088:Ubtfl1 UTSW 9 18409968 missense probably damaging 0.98
R4577:Ubtfl1 UTSW 9 18409493 missense probably damaging 1.00
R5057:Ubtfl1 UTSW 9 18409191 missense possibly damaging 0.83
R5224:Ubtfl1 UTSW 9 18410030 missense probably benign 0.34
R5284:Ubtfl1 UTSW 9 18409445 nonsense probably null
R5965:Ubtfl1 UTSW 9 18409542 missense probably benign 0.04
R6261:Ubtfl1 UTSW 9 18409296 missense possibly damaging 0.65
R6449:Ubtfl1 UTSW 9 18409629 missense possibly damaging 0.88
R6951:Ubtfl1 UTSW 9 18409577 missense probably benign 0.03
R7130:Ubtfl1 UTSW 9 18409847 missense probably damaging 1.00
R7133:Ubtfl1 UTSW 9 18409635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATTATCCACTTATACTGTCAATAG -3'
(R):5'- CACTAATTCTGTCAGTGTGCGG -3'

Sequencing Primer
(F):5'- TACAGATGGTTGTGAGCCACC -3'
(R):5'- TCAGTGTGCGGAACTTCC -3'
Posted On2015-04-06