Incidental Mutation 'R3836:Tpbg'
ID275650
Institutional Source Beutler Lab
Gene Symbol Tpbg
Ensembl Gene ENSMUSG00000035274
Gene Nametrophoblast glycoprotein
Synonyms5T4 oncofetal antigen, 5T4
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85842380-85847040 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 85843114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]
Predicted Effect probably benign
Transcript: ENSMUST00000006559
SMART Domains Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069896
SMART Domains Protein: ENSMUSP00000126873
Gene: ENSMUSG00000056031

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 68 88 N/A INTRINSIC
low complexity region 103 122 N/A INTRINSIC
low complexity region 150 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098500
SMART Domains Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LRRNT 61 95 1.27e-6 SMART
LRR 94 113 1.53e2 SMART
LRR_TYP 117 140 1.92e-2 SMART
LRR_TYP 141 164 6.88e-4 SMART
LRR 215 238 6.22e0 SMART
LRR_TYP 239 262 2.2e-2 SMART
LRR 263 286 2.67e-1 SMART
LRRCT 300 351 9.1e-14 SMART
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189191
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Tpbg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Tpbg APN 9 85844092 missense unknown
IGL01789:Tpbg APN 9 85844901 missense probably benign 0.00
IGL01987:Tpbg APN 9 85845199 missense probably damaging 1.00
R0399:Tpbg UTSW 9 85844938 missense possibly damaging 0.63
R0418:Tpbg UTSW 9 85844750 nonsense probably null
R0904:Tpbg UTSW 9 85844564 missense unknown
R1748:Tpbg UTSW 9 85844376 missense probably damaging 1.00
R3744:Tpbg UTSW 9 85845162 missense probably damaging 1.00
R3837:Tpbg UTSW 9 85843114 intron probably benign
R3839:Tpbg UTSW 9 85843114 intron probably benign
R5221:Tpbg UTSW 9 85844425 missense probably damaging 1.00
R6488:Tpbg UTSW 9 85844485 missense possibly damaging 0.70
R7192:Tpbg UTSW 9 85844032 nonsense probably null
R7462:Tpbg UTSW 9 85844850 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCTCATTTATCTCCGCCTAGGG -3'
(R):5'- TGGGATGAGAGCGAAGTTTC -3'

Sequencing Primer
(F):5'- CCCTCGGAGTTGGCTTTGC -3'
(R):5'- CCTCCTTGGATTAGTGTGA -3'
Posted On2015-04-06