Mutagenetix > Incidental Mutations

Incidental Mutation 'R3836:Tpbg'

275650

Institutional Source

Beutler Lab

Gene Symbol

Tpbg

Ensembl Gene

ENSMUSG00000035274

Gene Name

trophoblast glycoprotein

Synonyms

5T4 oncofetal antigen, 5T4

MMRRC Submission

040891-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.389) question?

Stock #

R3836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85842380-85847040 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 85843114 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000096101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006559] [ENSMUST00000098500]

Predicted Effect

probably benign
Transcript: ENSMUST00000006559

SMART Domains

Protein: ENSMUSP00000006559
Gene: ENSMUSG00000035274

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LRRNT	61	95	1.27e-6	SMART
LRR	94	113	1.53e2	SMART
LRR_TYP	117	140	1.92e-2	SMART
LRR_TYP	141	164	6.88e-4	SMART
LRR	215	238	6.22e0	SMART
LRR_TYP	239	262	2.2e-2	SMART
LRR	263	286	2.67e-1	SMART
LRRCT	300	351	9.1e-14	SMART
transmembrane domain	360	382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069896

SMART Domains

Protein: ENSMUSP00000126873
Gene: ENSMUSG00000056031

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	68	88	N/A	INTRINSIC
low complexity region	103	122	N/A	INTRINSIC
low complexity region	150	193	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098500

SMART Domains

Protein: ENSMUSP00000096101
Gene: ENSMUSG00000035274

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
LRRNT	61	95	1.27e-6	SMART
LRR	94	113	1.53e2	SMART
LRR_TYP	117	140	1.92e-2	SMART
LRR_TYP	141	164	6.88e-4	SMART
LRR	215	238	6.22e0	SMART
LRR_TYP	239	262	2.2e-2	SMART
LRR	263	286	2.67e-1	SMART
LRRCT	300	351	9.1e-14	SMART
transmembrane domain	360	382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185559

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187891

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189191

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich transmembrane glycoprotein that may be involved in cell adhesion. The encoded protein is an oncofetal antigen that is specific to trophoblast cells. In adults this protein is highly expressed in many tumor cells and is associated with poor clinical outcome in numerous cancers. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit low penetrance hydrocephaly and premature death. Embryonic stem cells isolated from these mice exhibit impaired mesenchyme differentiation and reduced chemotaxis following differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028I16Rik	A	G	10: 82,812,385		noncoding transcript	Het
Aasdh	A	G	5: 76,878,468	V903A	probably benign	Het
Ankrd6	T	A	4: 32,817,531	D271V	probably damaging	Het
Ano10	C	T	9: 122,263,763	V167M	possibly damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
AW551984	T	C	9: 39,597,908		probably benign	Het
Bub1	G	T	2: 127,814,886	P442Q	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Comp	A	G	8: 70,373,859	D28G	probably benign	Het
Crym	A	G	7: 120,201,216	V61A	probably benign	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Dtna	A	T	18: 23,625,102	Q488L	probably damaging	Het
Ecel1	A	C	1: 87,150,656	L565R	probably damaging	Het
Extl2	T	C	3: 116,024,357	I106T	probably benign	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fnbp4	A	G	2: 90,746,785	T154A	probably damaging	Het
Fsip2	T	C	2: 82,950,946	L32P	probably damaging	Het
Gldc	T	A	19: 30,118,675		probably benign	Het
Gm12695	T	G	4: 96,762,097	T171P	probably damaging	Het
Gm4868	A	C	5: 125,847,950		noncoding transcript	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Gstm5	T	C	3: 107,896,362	I37T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itga11	G	T	9: 62,769,283	V918L	probably benign	Het
Itgb2l	T	A	16: 96,426,167	M559L	probably benign	Het
Itih1	T	A	14: 30,935,828	N429Y	probably damaging	Het
Madd	A	T	2: 91,154,643		probably null	Het
Map3k11	A	G	19: 5,690,803	E186G	possibly damaging	Het
Mbl2	T	C	19: 30,239,514	F242S	probably damaging	Het
Mcph1	A	G	8: 18,622,659	T102A	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mkln1	A	G	6: 31,468,336	D389G	probably damaging	Het
Mmrn1	G	A	6: 60,944,847	S96N	probably benign	Het
Myd88	A	G	9: 119,338,193		probably benign	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nprl3	C	T	11: 32,233,082	E502K	probably damaging	Het
Nudt5	T	A	2: 5,866,347		probably null	Het
Olfr1045	A	G	2: 86,198,662	V30A	probably benign	Het
Olfr191	A	G	16: 59,086,223	S87P	possibly damaging	Het
Olfr691	G	A	7: 105,337,210	P169S	probably benign	Het
Olfr810	C	T	10: 129,791,170	V140M	probably benign	Het
Plaa	T	C	4: 94,586,922		probably null	Het
Ptk2b	A	G	14: 66,156,342	L894P	probably damaging	Het
Rab8b	A	G	9: 66,847,796	S183P	probably benign	Het
Reln	A	G	5: 21,911,014	Y2999H	probably damaging	Het
Rims4	A	G	2: 163,918,653	S11P	possibly damaging	Het
Scel	A	G	14: 103,592,386	K448R	possibly damaging	Het
Serpinb10	A	T	1: 107,536,086	T33S	probably benign	Het
Sgip1	A	G	4: 102,867,700		probably null	Het
Spata5	T	A	3: 37,433,643	Y428N	possibly damaging	Het
Sv2b	A	T	7: 75,157,428	M158K	probably damaging	Het
Tmem132d	A	T	5: 127,784,885	I724N	probably damaging	Het
Tnrc6c	A	G	11: 117,723,229	T738A	probably benign	Het
Tubb2a	G	T	13: 34,075,311	N165K	probably benign	Het
Ubtfl1	A	T	9: 18,409,237	E20D	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r25	C	A	6: 123,853,085	D36Y	probably damaging	Het
Wdhd1	A	G	14: 47,245,054	V946A	probably benign	Het
Wnk1	T	C	6: 119,950,043	E1265G	probably damaging	Het
Zmynd8	G	A	2: 165,858,099	T14I	probably benign	Het

Other mutations in Tpbg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01393:Tpbg	APN	9	85844092	missense	unknown
IGL01789:Tpbg	APN	9	85844901	missense	probably benign	0.00
IGL01987:Tpbg	APN	9	85845199	missense	probably damaging	1.00
R0399:Tpbg	UTSW	9	85844938	missense	possibly damaging	0.63
R0418:Tpbg	UTSW	9	85844750	nonsense	probably null
R0904:Tpbg	UTSW	9	85844564	missense	unknown
R1748:Tpbg	UTSW	9	85844376	missense	probably damaging	1.00
R3744:Tpbg	UTSW	9	85845162	missense	probably damaging	1.00
R3837:Tpbg	UTSW	9	85843114	intron	probably benign
R3839:Tpbg	UTSW	9	85843114	intron	probably benign
R5221:Tpbg	UTSW	9	85844425	missense	probably damaging	1.00
R6488:Tpbg	UTSW	9	85844485	missense	possibly damaging	0.70
R7192:Tpbg	UTSW	9	85844032	nonsense	probably null
R7462:Tpbg	UTSW	9	85844850	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GCTCATTTATCTCCGCCTAGGG -3'
(R):5'- TGGGATGAGAGCGAAGTTTC -3'

Sequencing Primer
(F):5'- CCCTCGGAGTTGGCTTTGC -3'
(R):5'- CCTCCTTGGATTAGTGTGA -3'

Posted On

2015-04-06