Incidental Mutation 'R3836:Itih1'
ID275662
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 040891-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30935828 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 429 (N429Y)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably damaging
Transcript: ENSMUST00000006704
AA Change: N433Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: N433Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163118
AA Change: N429Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: N429Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TCTAGGCTGTTAGGCAAACG -3'
(R):5'- TTCCAGCTGTCACAGTTGCC -3'

Sequencing Primer
(F):5'- GCAAACGGCCACCAGAG -3'
(R):5'- CCCAGTTGTCAATGGGGACTG -3'
Posted On2015-04-06