Incidental Mutation 'R3836:Ptk2b'
ID275664
Institutional Source Beutler Lab
Gene Symbol Ptk2b
Ensembl Gene ENSMUSG00000059456
Gene NamePTK2 protein tyrosine kinase 2 beta
SynonymsCAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase
MMRRC Submission 040891-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location66153257-66281052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66156342 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 894 (L894P)
Ref Sequence ENSEMBL: ENSMUSP00000137008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]
Predicted Effect probably benign
Transcript: ENSMUST00000022620
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022622
AA Change: L894P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: L894P

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089250
AA Change: L852P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: L852P

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111121
AA Change: L890P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: L890P

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 866 1004 1.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148104
Predicted Effect unknown
Transcript: ENSMUST00000154865
AA Change: L266P
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: L266P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178730
AA Change: L894P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: L894P

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Meta Mutation Damage Score 0.8955 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gldc T A 19: 30,118,675 probably benign Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Ptk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Ptk2b APN 14 66177118 missense possibly damaging 0.54
IGL01940:Ptk2b APN 14 66158613 missense probably benign 0.00
IGL02121:Ptk2b APN 14 66213482 missense probably benign 0.12
IGL02505:Ptk2b APN 14 66154243 missense probably damaging 1.00
IGL03036:Ptk2b APN 14 66173895 splice site probably benign
IGL03343:Ptk2b APN 14 66169421 missense probably benign 0.10
FR4548:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
FR4737:Ptk2b UTSW 14 66173849 missense possibly damaging 0.95
R0217:Ptk2b UTSW 14 66156381 missense probably damaging 1.00
R0478:Ptk2b UTSW 14 66213372 missense probably damaging 1.00
R0556:Ptk2b UTSW 14 66172144 missense probably damaging 1.00
R0631:Ptk2b UTSW 14 66177751 missense probably damaging 0.96
R0946:Ptk2b UTSW 14 66158598 missense probably benign 0.02
R1502:Ptk2b UTSW 14 66163080 missense possibly damaging 0.95
R1583:Ptk2b UTSW 14 66163114 missense possibly damaging 0.75
R1876:Ptk2b UTSW 14 66158392 missense probably benign 0.01
R1905:Ptk2b UTSW 14 66158670 missense probably damaging 1.00
R1942:Ptk2b UTSW 14 66169381 missense probably damaging 1.00
R2048:Ptk2b UTSW 14 66172505 missense probably benign 0.28
R2377:Ptk2b UTSW 14 66172548 missense possibly damaging 0.56
R3021:Ptk2b UTSW 14 66178183 splice site probably null
R3793:Ptk2b UTSW 14 66170251 missense probably damaging 1.00
R3911:Ptk2b UTSW 14 66157068 missense possibly damaging 0.83
R4654:Ptk2b UTSW 14 66163047 missense possibly damaging 0.86
R4690:Ptk2b UTSW 14 66173300 splice site probably null
R4691:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4692:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4693:Ptk2b UTSW 14 66157069 missense probably benign 0.16
R4847:Ptk2b UTSW 14 66173882 missense probably damaging 1.00
R5176:Ptk2b UTSW 14 66156415 missense probably damaging 1.00
R5297:Ptk2b UTSW 14 66172517 missense probably benign 0.04
R5603:Ptk2b UTSW 14 66172065 nonsense probably null
R5935:Ptk2b UTSW 14 66173879 missense probably damaging 1.00
R6245:Ptk2b UTSW 14 66163066 missense probably damaging 1.00
R6313:Ptk2b UTSW 14 66178831 missense probably damaging 1.00
R6476:Ptk2b UTSW 14 66187474 missense possibly damaging 0.81
R6858:Ptk2b UTSW 14 66213398 missense probably damaging 1.00
R7235:Ptk2b UTSW 14 66157087 nonsense probably null
R7511:Ptk2b UTSW 14 66154244 missense possibly damaging 0.81
R7558:Ptk2b UTSW 14 66154179 missense possibly damaging 0.83
X0054:Ptk2b UTSW 14 66213328 missense probably benign 0.15
Y5405:Ptk2b UTSW 14 66154094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGATAGCATCTGCCCTCTGAG -3'
(R):5'- TGGTTGATATCTGTGCATTCCC -3'

Sequencing Primer
(F):5'- AGACTGCCTGGGATTGAACTTCC -3'
(R):5'- TTCCCAGGAATGAATAATAGTGGTAG -3'
Posted On2015-04-06