Mutagenetix > Incidental Mutations

Incidental Mutation 'R3836:Ptk2b'

275664

Institutional Source

Beutler Lab

Gene Symbol

Ptk2b

Ensembl Gene

ENSMUSG00000059456

Gene Name

PTK2 protein tyrosine kinase 2 beta

Synonyms

CAKbeta, cellular adhesion kinase beta, E430023O05Rik, proline-rich tyrosine kinase 2, Raftk, related adhesion focal tyrosine kinase, PYK2, calcium-dependent tyrosine kinase

MMRRC Submission

040891-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R3836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66153257-66281052 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66156342 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 894 (L894P)

Ref Sequence

ENSEMBL: ENSMUSP00000137008 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000111121] [ENSMUST00000178730]

Predicted Effect

probably benign
Transcript: ENSMUST00000022620

SMART Domains

Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041

Domain	Start	End	E-Value	Type
Pfam:Neur_chan_LBD	36	242	2.2e-81	PFAM
Pfam:Neur_chan_memb	249	503	5e-97	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000022622
AA Change: L894P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456
AA Change: L894P

Domain	Start	End	E-Value	Type
B41	35	265	1.33e-45	SMART
TyrKc	425	679	1.46e-139	SMART
low complexity region	713	726	N/A	INTRINSIC
Pfam:Focal_AT	870	1008	1.7e-67	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089250
AA Change: L852P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456
AA Change: L852P

Domain	Start	End	E-Value	Type
B41	35	265	1.33e-45	SMART
TyrKc	425	679	1.46e-139	SMART
low complexity region	713	726	N/A	INTRINSIC
Pfam:Focal_AT	828	966	2e-68	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111121
AA Change: L890P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106750
Gene: ENSMUSG00000059456
AA Change: L890P

Domain	Start	End	E-Value	Type
B41	35	265	1.33e-45	SMART
TyrKc	425	679	1.46e-139	SMART
low complexity region	713	726	N/A	INTRINSIC
Pfam:Focal_AT	866	1004	1.1e-67	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136216

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148104

Predicted Effect

unknown
Transcript: ENSMUST00000154865
AA Change: L266P

SMART Domains

Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456
AA Change: L266P

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	1	83	8.5e-27	PFAM
low complexity region	117	130	N/A	INTRINSIC
Pfam:Focal_AT	243	375	5e-57	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000178730
AA Change: L894P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456
AA Change: L894P

Domain	Start	End	E-Value	Type
B41	35	265	1.33e-45	SMART
TyrKc	425	679	1.46e-139	SMART
low complexity region	713	726	N/A	INTRINSIC
Pfam:Focal_AT	870	1002	2.1e-55	PFAM

Meta Mutation Damage Score

0.8955

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show alterations in endothelial nitric oxide synthase-mediated vascular function and angiogenic responses. Mice homozygous for a second knock-out allele exhibit multiple defects in macrophage migration and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028I16Rik	A	G	10: 82,812,385		noncoding transcript	Het
Aasdh	A	G	5: 76,878,468	V903A	probably benign	Het
Ankrd6	T	A	4: 32,817,531	D271V	probably damaging	Het
Ano10	C	T	9: 122,263,763	V167M	possibly damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
AW551984	T	C	9: 39,597,908		probably benign	Het
Bub1	G	T	2: 127,814,886	P442Q	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Comp	A	G	8: 70,373,859	D28G	probably benign	Het
Crym	A	G	7: 120,201,216	V61A	probably benign	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Dtna	A	T	18: 23,625,102	Q488L	probably damaging	Het
Ecel1	A	C	1: 87,150,656	L565R	probably damaging	Het
Extl2	T	C	3: 116,024,357	I106T	probably benign	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fnbp4	A	G	2: 90,746,785	T154A	probably damaging	Het
Fsip2	T	C	2: 82,950,946	L32P	probably damaging	Het
Gldc	T	A	19: 30,118,675		probably benign	Het
Gm12695	T	G	4: 96,762,097	T171P	probably damaging	Het
Gm4868	A	C	5: 125,847,950		noncoding transcript	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Gstm5	T	C	3: 107,896,362	I37T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itga11	G	T	9: 62,769,283	V918L	probably benign	Het
Itgb2l	T	A	16: 96,426,167	M559L	probably benign	Het
Itih1	T	A	14: 30,935,828	N429Y	probably damaging	Het
Madd	A	T	2: 91,154,643		probably null	Het
Map3k11	A	G	19: 5,690,803	E186G	possibly damaging	Het
Mbl2	T	C	19: 30,239,514	F242S	probably damaging	Het
Mcph1	A	G	8: 18,622,659	T102A	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mkln1	A	G	6: 31,468,336	D389G	probably damaging	Het
Mmrn1	G	A	6: 60,944,847	S96N	probably benign	Het
Myd88	A	G	9: 119,338,193		probably benign	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nprl3	C	T	11: 32,233,082	E502K	probably damaging	Het
Nudt5	T	A	2: 5,866,347		probably null	Het
Olfr1045	A	G	2: 86,198,662	V30A	probably benign	Het
Olfr191	A	G	16: 59,086,223	S87P	possibly damaging	Het
Olfr691	G	A	7: 105,337,210	P169S	probably benign	Het
Olfr810	C	T	10: 129,791,170	V140M	probably benign	Het
Plaa	T	C	4: 94,586,922		probably null	Het
Rab8b	A	G	9: 66,847,796	S183P	probably benign	Het
Reln	A	G	5: 21,911,014	Y2999H	probably damaging	Het
Rims4	A	G	2: 163,918,653	S11P	possibly damaging	Het
Scel	A	G	14: 103,592,386	K448R	possibly damaging	Het
Serpinb10	A	T	1: 107,536,086	T33S	probably benign	Het
Sgip1	A	G	4: 102,867,700		probably null	Het
Spata5	T	A	3: 37,433,643	Y428N	possibly damaging	Het
Sv2b	A	T	7: 75,157,428	M158K	probably damaging	Het
Tmem132d	A	T	5: 127,784,885	I724N	probably damaging	Het
Tnrc6c	A	G	11: 117,723,229	T738A	probably benign	Het
Tpbg	T	C	9: 85,843,114		probably benign	Het
Tubb2a	G	T	13: 34,075,311	N165K	probably benign	Het
Ubtfl1	A	T	9: 18,409,237	E20D	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r25	C	A	6: 123,853,085	D36Y	probably damaging	Het
Wdhd1	A	G	14: 47,245,054	V946A	probably benign	Het
Wnk1	T	C	6: 119,950,043	E1265G	probably damaging	Het
Zmynd8	G	A	2: 165,858,099	T14I	probably benign	Het

Other mutations in Ptk2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Ptk2b	APN	14	66177118	missense	possibly damaging	0.54
IGL01940:Ptk2b	APN	14	66158613	missense	probably benign	0.00
IGL02121:Ptk2b	APN	14	66213482	missense	probably benign	0.12
IGL02505:Ptk2b	APN	14	66154243	missense	probably damaging	1.00
IGL03036:Ptk2b	APN	14	66173895	splice site	probably benign
IGL03343:Ptk2b	APN	14	66169421	missense	probably benign	0.10
FR4548:Ptk2b	UTSW	14	66173849	missense	possibly damaging	0.95
FR4737:Ptk2b	UTSW	14	66173849	missense	possibly damaging	0.95
R0217:Ptk2b	UTSW	14	66156381	missense	probably damaging	1.00
R0478:Ptk2b	UTSW	14	66213372	missense	probably damaging	1.00
R0556:Ptk2b	UTSW	14	66172144	missense	probably damaging	1.00
R0631:Ptk2b	UTSW	14	66177751	missense	probably damaging	0.96
R0946:Ptk2b	UTSW	14	66158598	missense	probably benign	0.02
R1502:Ptk2b	UTSW	14	66163080	missense	possibly damaging	0.95
R1583:Ptk2b	UTSW	14	66163114	missense	possibly damaging	0.75
R1876:Ptk2b	UTSW	14	66158392	missense	probably benign	0.01
R1905:Ptk2b	UTSW	14	66158670	missense	probably damaging	1.00
R1942:Ptk2b	UTSW	14	66169381	missense	probably damaging	1.00
R2048:Ptk2b	UTSW	14	66172505	missense	probably benign	0.28
R2377:Ptk2b	UTSW	14	66172548	missense	possibly damaging	0.56
R3021:Ptk2b	UTSW	14	66178183	splice site	probably null
R3793:Ptk2b	UTSW	14	66170251	missense	probably damaging	1.00
R3911:Ptk2b	UTSW	14	66157068	missense	possibly damaging	0.83
R4654:Ptk2b	UTSW	14	66163047	missense	possibly damaging	0.86
R4690:Ptk2b	UTSW	14	66173300	splice site	probably null
R4691:Ptk2b	UTSW	14	66157069	missense	probably benign	0.16
R4692:Ptk2b	UTSW	14	66157069	missense	probably benign	0.16
R4693:Ptk2b	UTSW	14	66157069	missense	probably benign	0.16
R4847:Ptk2b	UTSW	14	66173882	missense	probably damaging	1.00
R5176:Ptk2b	UTSW	14	66156415	missense	probably damaging	1.00
R5297:Ptk2b	UTSW	14	66172517	missense	probably benign	0.04
R5603:Ptk2b	UTSW	14	66172065	nonsense	probably null
R5935:Ptk2b	UTSW	14	66173879	missense	probably damaging	1.00
R6245:Ptk2b	UTSW	14	66163066	missense	probably damaging	1.00
R6313:Ptk2b	UTSW	14	66178831	missense	probably damaging	1.00
R6476:Ptk2b	UTSW	14	66187474	missense	possibly damaging	0.81
R6858:Ptk2b	UTSW	14	66213398	missense	probably damaging	1.00
R7235:Ptk2b	UTSW	14	66157087	nonsense	probably null
R7511:Ptk2b	UTSW	14	66154244	missense	possibly damaging	0.81
R7558:Ptk2b	UTSW	14	66154179	missense	possibly damaging	0.83
R7838:Ptk2b	UTSW	14	66158401	missense	probably benign
R8520:Ptk2b	UTSW	14	66174755	missense	probably damaging	1.00
X0054:Ptk2b	UTSW	14	66213328	missense	probably benign	0.15
Y5405:Ptk2b	UTSW	14	66154094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGATAGCATCTGCCCTCTGAG -3'
(R):5'- TGGTTGATATCTGTGCATTCCC -3'

Sequencing Primer
(F):5'- AGACTGCCTGGGATTGAACTTCC -3'
(R):5'- TTCCCAGGAATGAATAATAGTGGTAG -3'

Posted On

2015-04-06