Mutagenetix > Incidental Mutation

Incidental Mutation 'R3836:Gldc'

275671

Institutional Source

Beutler Lab

Gene Symbol

Gldc

Ensembl Gene

ENSMUSG00000024827

Gene Name

glycine decarboxylase

Synonyms

D030049L12Rik, D19Wsu57e

MMRRC Submission

040891-MU

Accession Numbers

Genbank: NM_138595.1

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3836 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30098449-30175418 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 30118675 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025778]

AlphaFold

Q91W43

Predicted Effect

probably benign
Transcript: ENSMUST00000025778

SMART Domains

Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

Domain	Start	End	E-Value	Type
low complexity region	5	28	N/A	INTRINSIC
low complexity region	33	56	N/A	INTRINSIC
Pfam:GDC-P	70	493	1.1e-202	PFAM
low complexity region	504	515	N/A	INTRINSIC
Pfam:GDC-P	519	798	6.5e-8	PFAM
Pfam:Beta_elim_lyase	589	745	2e-10	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028I16Rik	A	G	10: 82,812,385		noncoding transcript	Het
Aasdh	A	G	5: 76,878,468	V903A	probably benign	Het
Ankrd6	T	A	4: 32,817,531	D271V	probably damaging	Het
Ano10	C	T	9: 122,263,763	V167M	possibly damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
AW551984	T	C	9: 39,597,908		probably benign	Het
Bub1	G	T	2: 127,814,886	P442Q	probably damaging	Het
Clstn1	A	G	4: 149,638,333	E476G	probably damaging	Het
Comp	A	G	8: 70,373,859	D28G	probably benign	Het
Crym	A	G	7: 120,201,216	V61A	probably benign	Het
Dock4	G	T	12: 40,794,624		probably null	Het
Dtna	A	T	18: 23,625,102	Q488L	probably damaging	Het
Ecel1	A	C	1: 87,150,656	L565R	probably damaging	Het
Extl2	T	C	3: 116,024,357	I106T	probably benign	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fnbp4	A	G	2: 90,746,785	T154A	probably damaging	Het
Fsip2	T	C	2: 82,950,946	L32P	probably damaging	Het
Gm12695	T	G	4: 96,762,097	T171P	probably damaging	Het
Gm4868	A	C	5: 125,847,950		noncoding transcript	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Gstm5	T	C	3: 107,896,362	I37T	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Itga11	G	T	9: 62,769,283	V918L	probably benign	Het
Itgb2l	T	A	16: 96,426,167	M559L	probably benign	Het
Itih1	T	A	14: 30,935,828	N429Y	probably damaging	Het
Madd	A	T	2: 91,154,643		probably null	Het
Map3k11	A	G	19: 5,690,803	E186G	possibly damaging	Het
Mbl2	T	C	19: 30,239,514	F242S	probably damaging	Het
Mcph1	A	G	8: 18,622,659	T102A	possibly damaging	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mkln1	A	G	6: 31,468,336	D389G	probably damaging	Het
Mmrn1	G	A	6: 60,944,847	S96N	probably benign	Het
Myd88	A	G	9: 119,338,193		probably benign	Het
Nap1l1	T	A	10: 111,495,322		probably null	Het
Nprl3	C	T	11: 32,233,082	E502K	probably damaging	Het
Nudt5	T	A	2: 5,866,347		probably null	Het
Olfr1045	A	G	2: 86,198,662	V30A	probably benign	Het
Olfr191	A	G	16: 59,086,223	S87P	possibly damaging	Het
Olfr691	G	A	7: 105,337,210	P169S	probably benign	Het
Olfr810	C	T	10: 129,791,170	V140M	probably benign	Het
Plaa	T	C	4: 94,586,922		probably null	Het
Ptk2b	A	G	14: 66,156,342	L894P	probably damaging	Het
Rab8b	A	G	9: 66,847,796	S183P	probably benign	Het
Reln	A	G	5: 21,911,014	Y2999H	probably damaging	Het
Rims4	A	G	2: 163,918,653	S11P	possibly damaging	Het
Scel	A	G	14: 103,592,386	K448R	possibly damaging	Het
Serpinb10	A	T	1: 107,536,086	T33S	probably benign	Het
Sgip1	A	G	4: 102,867,700		probably null	Het
Spata5	T	A	3: 37,433,643	Y428N	possibly damaging	Het
Sv2b	A	T	7: 75,157,428	M158K	probably damaging	Het
Tmem132d	A	T	5: 127,784,885	I724N	probably damaging	Het
Tnrc6c	A	G	11: 117,723,229	T738A	probably benign	Het
Tpbg	T	C	9: 85,843,114		probably benign	Het
Tubb2a	G	T	13: 34,075,311	N165K	probably benign	Het
Ubtfl1	A	T	9: 18,409,237	E20D	possibly damaging	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn2r25	C	A	6: 123,853,085	D36Y	probably damaging	Het
Wdhd1	A	G	14: 47,245,054	V946A	probably benign	Het
Wnk1	T	C	6: 119,950,043	E1265G	probably damaging	Het
Zmynd8	G	A	2: 165,858,099	T14I	probably benign	Het

Other mutations in Gldc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Gldc	APN	19	30115240	missense	probably damaging	1.00
IGL01016:Gldc	APN	19	30133493	missense	possibly damaging	0.93
IGL01112:Gldc	APN	19	30158513	critical splice donor site	probably null
IGL01510:Gldc	APN	19	30113721	critical splice donor site	probably null
IGL01516:Gldc	APN	19	30099032	missense	probably damaging	1.00
IGL01598:Gldc	APN	19	30133756	missense	probably damaging	1.00
IGL01646:Gldc	APN	19	30100765	missense	possibly damaging	0.61
IGL02024:Gldc	APN	19	30100827	missense	probably damaging	1.00
IGL02125:Gldc	APN	19	30147241	missense	probably benign	0.03
IGL02548:Gldc	APN	19	30099899	missense	probably benign
IGL02711:Gldc	APN	19	30145146	critical splice donor site	probably null
IGL02818:Gldc	APN	19	30136509	missense	probably damaging	0.99
IGL02982:Gldc	APN	19	30145145	critical splice donor site	probably null
IGL03165:Gldc	APN	19	30098993	missense	possibly damaging	0.61
jojoba	UTSW	19	30133512	missense	probably damaging	1.00
miserable	UTSW	19	30151536	missense	probably damaging	1.00
Urchin	UTSW	19	30118602	missense	probably damaging	0.98
I2289:Gldc	UTSW	19	30147176	nonsense	probably null
R0180:Gldc	UTSW	19	30100817	missense	possibly damaging	0.95
R0269:Gldc	UTSW	19	30118602	missense	probably damaging	0.98
R0277:Gldc	UTSW	19	30116451	missense	possibly damaging	0.84
R1085:Gldc	UTSW	19	30151428	missense	probably damaging	1.00
R1159:Gldc	UTSW	19	30160762	intron	probably benign
R1500:Gldc	UTSW	19	30113825	missense	possibly damaging	0.88
R1507:Gldc	UTSW	19	30118638	missense	probably damaging	1.00
R1592:Gldc	UTSW	19	30160677	intron	probably benign
R1593:Gldc	UTSW	19	30113750	missense	probably damaging	1.00
R1675:Gldc	UTSW	19	30143453	missense	probably damaging	1.00
R1869:Gldc	UTSW	19	30139332	missense	probably benign
R1965:Gldc	UTSW	19	30137113	nonsense	probably null
R2312:Gldc	UTSW	19	30100826	missense	probably damaging	0.98
R2425:Gldc	UTSW	19	30131790	missense	probably damaging	1.00
R3837:Gldc	UTSW	19	30118675	splice site	probably benign
R3839:Gldc	UTSW	19	30118675	splice site	probably benign
R4191:Gldc	UTSW	19	30145658	missense	probably damaging	0.96
R4380:Gldc	UTSW	19	30160768	intron	probably benign
R4508:Gldc	UTSW	19	30143407	missense	probably damaging	1.00
R4570:Gldc	UTSW	19	30174439	missense	probably benign
R4655:Gldc	UTSW	19	30160702	intron	probably benign
R4842:Gldc	UTSW	19	30133732	missense	possibly damaging	0.94
R5070:Gldc	UTSW	19	30118598	missense	possibly damaging	0.84
R5085:Gldc	UTSW	19	30151536	missense	probably damaging	1.00
R5268:Gldc	UTSW	19	30145725	missense	probably damaging	0.96
R5368:Gldc	UTSW	19	30158521	missense	probably benign
R5718:Gldc	UTSW	19	30110772	nonsense	probably null
R5878:Gldc	UTSW	19	30143467	splice site	probably null
R6192:Gldc	UTSW	19	30133772	missense	probably damaging	0.98
R6453:Gldc	UTSW	19	30116517	missense	probably damaging	0.99
R6777:Gldc	UTSW	19	30133512	missense	probably damaging	1.00
R6865:Gldc	UTSW	19	30133762	missense	possibly damaging	0.92
R7332:Gldc	UTSW	19	30116526	missense	probably damaging	0.99
R7390:Gldc	UTSW	19	30099914	missense	possibly damaging	0.46
R7647:Gldc	UTSW	19	30118667	missense	probably damaging	0.96
R8081:Gldc	UTSW	19	30158587	frame shift	probably null
R8171:Gldc	UTSW	19	30133761	missense	probably benign	0.24
R8321:Gldc	UTSW	19	30143407	nonsense	probably null
R8374:Gldc	UTSW	19	30137194	missense	probably damaging	1.00
R8503:Gldc	UTSW	19	30099854	missense	probably benign	0.26
R8510:Gldc	UTSW	19	30116505	missense	probably damaging	1.00
R8785:Gldc	UTSW	19	30115234	missense	probably damaging	1.00
R8818:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8820:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8829:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8830:Gldc	UTSW	19	30100812	missense	probably benign	0.05
R8859:Gldc	UTSW	19	30139379	missense	probably damaging	1.00
R8887:Gldc	UTSW	19	30133756	missense	possibly damaging	0.94
R8935:Gldc	UTSW	19	30131693	missense	probably benign	0.00
R8940:Gldc	UTSW	19	30151484	missense	probably benign
R9070:Gldc	UTSW	19	30103004	missense	probably damaging	1.00
R9100:Gldc	UTSW	19	30099914	missense	possibly damaging	0.81
R9144:Gldc	UTSW	19	30137193	missense
R9163:Gldc	UTSW	19	30134286	missense	probably benign	0.13
R9429:Gldc	UTSW	19	30113772	missense	possibly damaging	0.88
Z1177:Gldc	UTSW	19	30110778	missense	probably damaging	1.00
Z1177:Gldc	UTSW	19	30110779	missense	probably damaging	0.99
Z1177:Gldc	UTSW	19	30145748	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- GGCCCTTTCCTAACCATGAC -3'
(R):5'- ACGGAAATTCCCCTTCAGGAC -3'

Sequencing Primer
(F):5'- ATGACATCACCATCATCTGTCC -3'
(R):5'- CAGGACATGGTTTTTGCAGTAACC -3'

Posted On

2015-04-06