Incidental Mutation 'R3836:Gldc'
ID 275671
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 040891-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3836 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 30096075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect probably benign
Transcript: ENSMUST00000025778
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,648,219 (GRCm39) noncoding transcript Het
Aasdh A G 5: 77,026,315 (GRCm39) V903A probably benign Het
Afg2a T A 3: 37,487,792 (GRCm39) Y428N possibly damaging Het
Ankrd6 T A 4: 32,817,531 (GRCm39) D271V probably damaging Het
Ano10 C T 9: 122,092,829 (GRCm39) V167M possibly damaging Het
Arhgef25 T C 10: 127,025,605 (GRCm39) T12A probably benign Het
AW551984 T C 9: 39,509,204 (GRCm39) probably benign Het
Bub1 G T 2: 127,656,806 (GRCm39) P442Q probably damaging Het
Clstn1 A G 4: 149,722,790 (GRCm39) E476G probably damaging Het
Comp A G 8: 70,826,509 (GRCm39) D28G probably benign Het
Crym A G 7: 119,800,439 (GRCm39) V61A probably benign Het
Dock4 G T 12: 40,844,623 (GRCm39) probably null Het
Dtna A T 18: 23,758,159 (GRCm39) Q488L probably damaging Het
Ecel1 A C 1: 87,078,378 (GRCm39) L565R probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Fam13c C T 10: 70,378,478 (GRCm39) S336L probably damaging Het
Fnbp4 A G 2: 90,577,129 (GRCm39) T154A probably damaging Het
Fsip2 T C 2: 82,781,290 (GRCm39) L32P probably damaging Het
Gm12695 T G 4: 96,650,334 (GRCm39) T171P probably damaging Het
Gm4868 A C 5: 125,925,014 (GRCm39) noncoding transcript Het
Gpam T C 19: 55,068,890 (GRCm39) N450S probably benign Het
Gstm5 T C 3: 107,803,678 (GRCm39) I37T probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Itga11 G T 9: 62,676,565 (GRCm39) V918L probably benign Het
Itgb2l T A 16: 96,227,367 (GRCm39) M559L probably benign Het
Itih1 T A 14: 30,657,785 (GRCm39) N429Y probably damaging Het
Madd A T 2: 90,984,988 (GRCm39) probably null Het
Map3k11 A G 19: 5,740,831 (GRCm39) E186G possibly damaging Het
Mbl2 T C 19: 30,216,914 (GRCm39) F242S probably damaging Het
Mcph1 A G 8: 18,672,675 (GRCm39) T102A possibly damaging Het
Mid1ip1 T C X: 10,584,620 (GRCm39) V51A possibly damaging Het
Mkln1 A G 6: 31,445,271 (GRCm39) D389G probably damaging Het
Mmrn1 G A 6: 60,921,831 (GRCm39) S96N probably benign Het
Myd88 A G 9: 119,167,259 (GRCm39) probably benign Het
Nap1l1 T A 10: 111,331,183 (GRCm39) probably null Het
Nprl3 C T 11: 32,183,082 (GRCm39) E502K probably damaging Het
Nudt5 T A 2: 5,871,158 (GRCm39) probably null Het
Or52b2 G A 7: 104,986,417 (GRCm39) P169S probably benign Het
Or5h23 A G 16: 58,906,586 (GRCm39) S87P possibly damaging Het
Or6c69b C T 10: 129,627,039 (GRCm39) V140M probably benign Het
Or8j3 A G 2: 86,029,006 (GRCm39) V30A probably benign Het
Plaa T C 4: 94,475,159 (GRCm39) probably null Het
Ptk2b A G 14: 66,393,791 (GRCm39) L894P probably damaging Het
Rab8b A G 9: 66,755,078 (GRCm39) S183P probably benign Het
Reln A G 5: 22,116,012 (GRCm39) Y2999H probably damaging Het
Rims4 A G 2: 163,760,573 (GRCm39) S11P possibly damaging Het
Scel A G 14: 103,829,822 (GRCm39) K448R possibly damaging Het
Serpinb10 A T 1: 107,463,816 (GRCm39) T33S probably benign Het
Sgip1 A G 4: 102,724,897 (GRCm39) probably null Het
Sv2b A T 7: 74,807,176 (GRCm39) M158K probably damaging Het
Tmem132d A T 5: 127,861,949 (GRCm39) I724N probably damaging Het
Tnrc6c A G 11: 117,614,055 (GRCm39) T738A probably benign Het
Tpbg T C 9: 85,725,167 (GRCm39) probably benign Het
Tubb2a G T 13: 34,259,294 (GRCm39) N165K probably benign Het
Ubtfl1 A T 9: 18,320,533 (GRCm39) E20D possibly damaging Het
Usp14 A G 18: 10,024,532 (GRCm39) probably null Het
Vmn2r25 C A 6: 123,830,044 (GRCm39) D36Y probably damaging Het
Wdhd1 A G 14: 47,482,511 (GRCm39) V946A probably benign Het
Wnk1 T C 6: 119,927,004 (GRCm39) E1265G probably damaging Het
Zmynd8 G A 2: 165,700,019 (GRCm39) T14I probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8887:Gldc UTSW 19 30,111,156 (GRCm39) missense possibly damaging 0.94
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCTTTCCTAACCATGAC -3'
(R):5'- ACGGAAATTCCCCTTCAGGAC -3'

Sequencing Primer
(F):5'- ATGACATCACCATCATCTGTCC -3'
(R):5'- CAGGACATGGTTTTTGCAGTAACC -3'
Posted On 2015-04-06