Incidental Mutation 'R3836:Gldc'
ID275671
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Nameglycine decarboxylase
SynonymsD030049L12Rik, D19Wsu57e
MMRRC Submission 040891-MU
Accession Numbers

Genbank: NM_138595.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3836 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location30098449-30175418 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 30118675 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
Predicted Effect probably benign
Transcript: ENSMUST00000025778
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Aasdh A G 5: 76,878,468 V903A probably benign Het
Ankrd6 T A 4: 32,817,531 D271V probably damaging Het
Ano10 C T 9: 122,263,763 V167M possibly damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
AW551984 T C 9: 39,597,908 probably benign Het
Bub1 G T 2: 127,814,886 P442Q probably damaging Het
Clstn1 A G 4: 149,638,333 E476G probably damaging Het
Comp A G 8: 70,373,859 D28G probably benign Het
Crym A G 7: 120,201,216 V61A probably benign Het
Dock4 G T 12: 40,794,624 probably null Het
Dtna A T 18: 23,625,102 Q488L probably damaging Het
Ecel1 A C 1: 87,150,656 L565R probably damaging Het
Extl2 T C 3: 116,024,357 I106T probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fnbp4 A G 2: 90,746,785 T154A probably damaging Het
Fsip2 T C 2: 82,950,946 L32P probably damaging Het
Gm12695 T G 4: 96,762,097 T171P probably damaging Het
Gm4868 A C 5: 125,847,950 noncoding transcript Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gstm5 T C 3: 107,896,362 I37T probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Itga11 G T 9: 62,769,283 V918L probably benign Het
Itgb2l T A 16: 96,426,167 M559L probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Madd A T 2: 91,154,643 probably null Het
Map3k11 A G 19: 5,690,803 E186G possibly damaging Het
Mbl2 T C 19: 30,239,514 F242S probably damaging Het
Mcph1 A G 8: 18,622,659 T102A possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mkln1 A G 6: 31,468,336 D389G probably damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Myd88 A G 9: 119,338,193 probably benign Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nprl3 C T 11: 32,233,082 E502K probably damaging Het
Nudt5 T A 2: 5,866,347 probably null Het
Olfr1045 A G 2: 86,198,662 V30A probably benign Het
Olfr191 A G 16: 59,086,223 S87P possibly damaging Het
Olfr691 G A 7: 105,337,210 P169S probably benign Het
Olfr810 C T 10: 129,791,170 V140M probably benign Het
Plaa T C 4: 94,586,922 probably null Het
Ptk2b A G 14: 66,156,342 L894P probably damaging Het
Rab8b A G 9: 66,847,796 S183P probably benign Het
Reln A G 5: 21,911,014 Y2999H probably damaging Het
Rims4 A G 2: 163,918,653 S11P possibly damaging Het
Scel A G 14: 103,592,386 K448R possibly damaging Het
Serpinb10 A T 1: 107,536,086 T33S probably benign Het
Sgip1 A G 4: 102,867,700 probably null Het
Spata5 T A 3: 37,433,643 Y428N possibly damaging Het
Sv2b A T 7: 75,157,428 M158K probably damaging Het
Tmem132d A T 5: 127,784,885 I724N probably damaging Het
Tnrc6c A G 11: 117,723,229 T738A probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Ubtfl1 A T 9: 18,409,237 E20D possibly damaging Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r25 C A 6: 123,853,085 D36Y probably damaging Het
Wdhd1 A G 14: 47,245,054 V946A probably benign Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Zmynd8 G A 2: 165,858,099 T14I probably benign Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30115240 missense probably damaging 1.00
IGL01016:Gldc APN 19 30133493 missense possibly damaging 0.93
IGL01112:Gldc APN 19 30158513 critical splice donor site probably null
IGL01510:Gldc APN 19 30113721 critical splice donor site probably null
IGL01516:Gldc APN 19 30099032 missense probably damaging 1.00
IGL01598:Gldc APN 19 30133756 missense probably damaging 1.00
IGL01646:Gldc APN 19 30100765 missense possibly damaging 0.61
IGL02024:Gldc APN 19 30100827 missense probably damaging 1.00
IGL02125:Gldc APN 19 30147241 missense probably benign 0.03
IGL02548:Gldc APN 19 30099899 missense probably benign
IGL02711:Gldc APN 19 30145146 critical splice donor site probably null
IGL02818:Gldc APN 19 30136509 missense probably damaging 0.99
IGL02982:Gldc APN 19 30145145 critical splice donor site probably null
IGL03165:Gldc APN 19 30098993 missense possibly damaging 0.61
jojoba UTSW 19 30133512 missense probably damaging 1.00
miserable UTSW 19 30151536 missense probably damaging 1.00
Urchin UTSW 19 30118602 missense probably damaging 0.98
I2289:Gldc UTSW 19 30147176 nonsense probably null
R0180:Gldc UTSW 19 30100817 missense possibly damaging 0.95
R0269:Gldc UTSW 19 30118602 missense probably damaging 0.98
R0277:Gldc UTSW 19 30116451 missense possibly damaging 0.84
R1085:Gldc UTSW 19 30151428 missense probably damaging 1.00
R1159:Gldc UTSW 19 30160762 intron probably benign
R1500:Gldc UTSW 19 30113825 missense possibly damaging 0.88
R1507:Gldc UTSW 19 30118638 missense probably damaging 1.00
R1592:Gldc UTSW 19 30160677 intron probably benign
R1593:Gldc UTSW 19 30113750 missense probably damaging 1.00
R1675:Gldc UTSW 19 30143453 missense probably damaging 1.00
R1869:Gldc UTSW 19 30139332 missense probably benign
R1965:Gldc UTSW 19 30137113 nonsense probably null
R2312:Gldc UTSW 19 30100826 missense probably damaging 0.98
R2425:Gldc UTSW 19 30131790 missense probably damaging 1.00
R3837:Gldc UTSW 19 30118675 splice site probably benign
R3839:Gldc UTSW 19 30118675 splice site probably benign
R4191:Gldc UTSW 19 30145658 missense probably damaging 0.96
R4380:Gldc UTSW 19 30160768 intron probably benign
R4508:Gldc UTSW 19 30143407 missense probably damaging 1.00
R4570:Gldc UTSW 19 30174439 missense probably benign
R4655:Gldc UTSW 19 30160702 intron probably benign
R4842:Gldc UTSW 19 30133732 missense possibly damaging 0.94
R5070:Gldc UTSW 19 30118598 missense possibly damaging 0.84
R5085:Gldc UTSW 19 30151536 missense probably damaging 1.00
R5268:Gldc UTSW 19 30145725 missense probably damaging 0.96
R5368:Gldc UTSW 19 30158521 missense probably benign
R5718:Gldc UTSW 19 30110772 nonsense probably null
R5878:Gldc UTSW 19 30143467 splice site probably null
R6192:Gldc UTSW 19 30133772 missense probably damaging 0.98
R6453:Gldc UTSW 19 30116517 missense probably damaging 0.99
R6777:Gldc UTSW 19 30133512 missense probably damaging 1.00
R6865:Gldc UTSW 19 30133762 missense possibly damaging 0.92
R7332:Gldc UTSW 19 30116526 missense probably damaging 0.99
R7390:Gldc UTSW 19 30099914 missense possibly damaging 0.46
R7647:Gldc UTSW 19 30118667 missense probably damaging 0.96
R8081:Gldc UTSW 19 30158587 frame shift probably null
R8171:Gldc UTSW 19 30133761 missense probably benign 0.24
R8321:Gldc UTSW 19 30143407 nonsense probably null
R8374:Gldc UTSW 19 30137194 missense probably damaging 1.00
R8503:Gldc UTSW 19 30099854 missense probably benign 0.26
R8510:Gldc UTSW 19 30116505 missense probably damaging 1.00
R8785:Gldc UTSW 19 30115234 missense probably damaging 1.00
R8818:Gldc UTSW 19 30100812 missense probably benign 0.05
R8820:Gldc UTSW 19 30100812 missense probably benign 0.05
R8829:Gldc UTSW 19 30100812 missense probably benign 0.05
R8830:Gldc UTSW 19 30100812 missense probably benign 0.05
R8859:Gldc UTSW 19 30139379 missense probably damaging 1.00
R8887:Gldc UTSW 19 30133756 missense possibly damaging 0.94
R8935:Gldc UTSW 19 30131693 missense probably benign 0.00
R8940:Gldc UTSW 19 30151484 missense probably benign
Z1177:Gldc UTSW 19 30110778 missense probably damaging 1.00
Z1177:Gldc UTSW 19 30110779 missense probably damaging 0.99
Z1177:Gldc UTSW 19 30145748 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGCCCTTTCCTAACCATGAC -3'
(R):5'- ACGGAAATTCCCCTTCAGGAC -3'

Sequencing Primer
(F):5'- ATGACATCACCATCATCTGTCC -3'
(R):5'- CAGGACATGGTTTTTGCAGTAACC -3'
Posted On2015-04-06