Incidental Mutation 'R3837:Zfp111'
ID275696
Institutional Source Beutler Lab
Gene Symbol Zfp111
Ensembl Gene ENSMUSG00000087598
Gene Namezinc finger protein 111
Synonyms
MMRRC Submission 040778-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24193947-24211443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24199466 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 241 (N241S)
Ref Sequence ENSEMBL: ENSMUSP00000129484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056683] [ENSMUST00000073833] [ENSMUST00000086006]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056683
AA Change: N241S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129484
Gene: ENSMUSG00000087598
AA Change: N241S

DomainStartEndE-ValueType
KRAB 9 64 1.8e-21 SMART
low complexity region 114 128 N/A INTRINSIC
ZnF_C2H2 210 232 2.3e-7 SMART
ZnF_C2H2 266 288 5.7e-4 SMART
ZnF_C2H2 294 316 3.3e-4 SMART
ZnF_C2H2 322 343 4.3e-1 SMART
ZnF_C2H2 349 371 4.5e-8 SMART
ZnF_C2H2 377 399 2.1e-6 SMART
ZnF_C2H2 405 427 8e-6 SMART
ZnF_C2H2 433 455 9.9e-5 SMART
ZnF_C2H2 461 481 4.3e-2 SMART
ZnF_C2H2 489 511 2.7e-5 SMART
ZnF_C2H2 517 539 1.1e-6 SMART
ZnF_C2H2 545 567 1.8e-5 SMART
ZnF_C2H2 573 595 3.5e-6 SMART
ZnF_C2H2 601 623 2.9e-6 SMART
ZnF_C2H2 629 651 1.3e-6 SMART
ZnF_C2H2 657 679 2.2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073833
AA Change: N240S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083174
Gene: ENSMUSG00000087598
AA Change: N240S

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086006
AA Change: N240S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083169
Gene: ENSMUSG00000087598
AA Change: N240S

DomainStartEndE-ValueType
KRAB 8 63 4.03e-19 SMART
low complexity region 113 127 N/A INTRINSIC
ZnF_C2H2 209 231 5.29e-5 SMART
ZnF_C2H2 265 287 1.33e-1 SMART
ZnF_C2H2 293 315 7.67e-2 SMART
ZnF_C2H2 321 342 1.01e2 SMART
ZnF_C2H2 348 370 1e-5 SMART
ZnF_C2H2 376 398 4.87e-4 SMART
ZnF_C2H2 404 426 1.82e-3 SMART
ZnF_C2H2 432 454 2.36e-2 SMART
ZnF_C2H2 460 480 9.96e0 SMART
ZnF_C2H2 488 510 6.32e-3 SMART
ZnF_C2H2 516 538 2.61e-4 SMART
ZnF_C2H2 544 566 4.17e-3 SMART
ZnF_C2H2 572 594 7.9e-4 SMART
ZnF_C2H2 600 622 6.88e-4 SMART
ZnF_C2H2 628 650 3.21e-4 SMART
ZnF_C2H2 656 678 5.14e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160563
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Other mutations in Zfp111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02569:Zfp111 APN 7 24207069 missense possibly damaging 0.91
IGL02619:Zfp111 APN 7 24199688 missense possibly damaging 0.75
FR4737:Zfp111 UTSW 7 24199805 small insertion probably benign
FR4976:Zfp111 UTSW 7 24199037 missense probably damaging 0.97
FR4976:Zfp111 UTSW 7 24199807 small insertion probably benign
R0514:Zfp111 UTSW 7 24199143 missense probably damaging 0.96
R4682:Zfp111 UTSW 7 24199138 missense probably damaging 0.98
R4844:Zfp111 UTSW 7 24199376 missense probably damaging 0.99
R6105:Zfp111 UTSW 7 24203366 splice site probably null
R6175:Zfp111 UTSW 7 24198129 missense unknown
R7276:Zfp111 UTSW 7 24199553 missense probably damaging 1.00
R7584:Zfp111 UTSW 7 24198600 missense possibly damaging 0.89
X0018:Zfp111 UTSW 7 24199991 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCAAGTTGAAGGGCTTCCC -3'
(R):5'- ACATAGTACGCAGGAGGACACC -3'

Sequencing Primer
(F):5'- AATCACACTTGGACGGTTTGC -3'
(R):5'- ACACCAGGCATAGCTTCAGTGTG -3'
Posted On2015-04-06