Incidental Mutation 'R3837:Tlr3'
ID275699
Institutional Source Beutler Lab
Gene Symbol Tlr3
Ensembl Gene ENSMUSG00000031639
Gene Nametoll-like receptor 3
Synonyms
MMRRC Submission 040778-MU
Accession Numbers

Ncbi RefSeq: NM_126166; MGI: 2156367

Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45395665-45411080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45396939 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 898 (L898F)
Ref Sequence ENSEMBL: ENSMUSP00000147738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209772] [ENSMUST00000210013]
Predicted Effect probably damaging
Transcript: ENSMUST00000034056
AA Change: L898F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: L898F

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167106
AA Change: L898F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: L898F

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209772
AA Change: L898F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210013
Meta Mutation Damage Score 0.2176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdc20b T C 13: 113,084,008 W432R probably damaging Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Tlr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tlr3 APN 8 45400690 missense probably damaging 0.99
IGL01820:Tlr3 APN 8 45398339 missense probably benign
IGL02504:Tlr3 APN 8 45397907 missense probably damaging 1.00
IGL02523:Tlr3 APN 8 45398391 unclassified probably null
IGL03166:Tlr3 APN 8 45402928 missense probably benign 0.05
IGL03287:Tlr3 APN 8 45402780 missense probably benign
Rakshasa UTSW 8 45397697 missense probably benign 0.08
Ultraman UTSW 8 45402981 missense probably damaging 1.00
E0354:Tlr3 UTSW 8 45400820 missense probably damaging 1.00
R0960:Tlr3 UTSW 8 45397415 missense probably damaging 1.00
R1175:Tlr3 UTSW 8 45397134 missense probably damaging 1.00
R1332:Tlr3 UTSW 8 45398737 missense probably damaging 0.99
R1477:Tlr3 UTSW 8 45398165 missense probably damaging 1.00
R1667:Tlr3 UTSW 8 45400837 missense probably benign 0.00
R1755:Tlr3 UTSW 8 45397973 missense probably benign
R1996:Tlr3 UTSW 8 45397697 missense probably benign 0.08
R2012:Tlr3 UTSW 8 45402786 missense possibly damaging 0.91
R2288:Tlr3 UTSW 8 45397668 missense probably damaging 0.98
R2895:Tlr3 UTSW 8 45397592 missense possibly damaging 0.89
R4905:Tlr3 UTSW 8 45399223 critical splice acceptor site probably null
R4934:Tlr3 UTSW 8 45397035 missense probably benign 0.10
R5025:Tlr3 UTSW 8 45403038 missense probably benign 0.00
R5086:Tlr3 UTSW 8 45402825 missense probably damaging 0.96
R5129:Tlr3 UTSW 8 45402981 missense probably damaging 1.00
R5320:Tlr3 UTSW 8 45399100 missense possibly damaging 0.95
R5411:Tlr3 UTSW 8 45396955 missense probably benign 0.01
R5497:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5498:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5499:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5501:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5731:Tlr3 UTSW 8 45398120 missense probably benign 0.00
R5761:Tlr3 UTSW 8 45402771 missense probably benign 0.00
R5992:Tlr3 UTSW 8 45397814 missense probably benign
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6104:Tlr3 UTSW 8 45403093 missense probably benign 0.00
R6289:Tlr3 UTSW 8 45396929 missense probably benign 0.04
R6372:Tlr3 UTSW 8 45397011 missense probably damaging 1.00
R6470:Tlr3 UTSW 8 45397385 missense probably damaging 1.00
R6486:Tlr3 UTSW 8 45398613 unclassified probably null
R6504:Tlr3 UTSW 8 45397449 missense possibly damaging 0.79
R6721:Tlr3 UTSW 8 45398880 missense probably benign 0.00
R7089:Tlr3 UTSW 8 45397773 missense probably benign 0.02
R7169:Tlr3 UTSW 8 45397019 missense probably damaging 1.00
R7679:Tlr3 UTSW 8 45399051 missense probably benign
R7771:Tlr3 UTSW 8 45403039 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGATGTCAATGAAATAAGCCG -3'
(R):5'- AAGGTACATCACGCAGTTCAG -3'

Sequencing Primer
(F):5'- GCCGAAATATTTCAAAACTGAGATTG -3'
(R):5'- CGCAGTTCAGCAAGCTATTG -3'
Posted On2015-04-06