Mutagenetix > Incidental Mutations

Incidental Mutation 'R3837:Nap1l1'

275706

Institutional Source

Beutler Lab

Gene Symbol

Nap1l1

Ensembl Gene

ENSMUSG00000058799

Gene Name

nucleosome assembly protein 1-like 1

Synonyms

D10Ertd68e

MMRRC Submission

040778-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.289) question?

Stock #

R3837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111473223-111498150 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 111495322 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065917] [ENSMUST00000171797] [ENSMUST00000217908] [ENSMUST00000218828] [ENSMUST00000219143] [ENSMUST00000219961]

AlphaFold

P28656

Predicted Effect

probably null
Transcript: ENSMUST00000065917

SMART Domains

Protein: ENSMUSP00000070068
Gene: ENSMUSG00000058799

Domain	Start	End	E-Value	Type
coiled coil region	6	31	N/A	INTRINSIC
Pfam:NAP	75	346	1.5e-96	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000171797

SMART Domains

Protein: ENSMUSP00000126850
Gene: ENSMUSG00000058799

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
coiled coil region	33	58	N/A	INTRINSIC
Pfam:NAP	103	372	9.6e-110	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000217908

Predicted Effect

probably null
Transcript: ENSMUST00000218828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218982

Predicted Effect

probably benign
Transcript: ENSMUST00000219143

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219718

Predicted Effect

probably benign
Transcript: ENSMUST00000219961

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing results in multiple transcript variants encoding different isoforms; however, not all have been fully described. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028I16Rik	A	G	10: 82,812,385		noncoding transcript	Het
4930474N05Rik	G	A	14: 36,095,478	G112S	probably benign	Het
Adam24	T	C	8: 40,680,545	S351P	probably benign	Het
Amigo2	T	C	15: 97,245,315	I409V	probably damaging	Het
Arhgef25	T	C	10: 127,189,736	T12A	probably benign	Het
Atg10	A	T	13: 90,937,380	I150K	probably damaging	Het
AW551984	T	C	9: 39,597,908		probably benign	Het
Cdc20b	T	C	13: 113,084,008	W432R	probably damaging	Het
Cdh9	G	T	15: 16,823,438	E169*	probably null	Het
Col28a1	C	T	6: 8,014,601	V935M	possibly damaging	Het
Col6a3	T	C	1: 90,780,081	N1948D	unknown	Het
Dnajb2	G	A	1: 75,241,480		probably null	Het
Fam13c	C	T	10: 70,542,648	S336L	probably damaging	Het
Fam35a	A	G	14: 34,249,185	V581A	probably damaging	Het
Fn1	A	T	1: 71,653,155		probably null	Het
Fryl	T	C	5: 73,071,265	T1708A	probably benign	Het
Gcnt4	A	T	13: 96,947,014	R273*	probably null	Het
Gldc	T	A	19: 30,118,675		probably benign	Het
Glra2	C	T	X: 165,289,616	V85I	probably benign	Het
Gm11562	A	G	11: 99,620,200	I58T	possibly damaging	Het
Gpam	T	C	19: 55,080,458	N450S	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hmcn2	T	C	2: 31,413,407	L3020P	probably damaging	Het
Hmgcr	A	G	13: 96,659,089	I324T	probably benign	Het
Itih1	T	A	14: 30,935,828	N429Y	probably damaging	Het
Lamtor1	T	C	7: 101,910,108		probably null	Het
Lrrd1	A	T	5: 3,850,204	I170L	possibly damaging	Het
Magi2	G	A	5: 20,215,468	D301N	probably benign	Het
Mid1ip1	T	C	X: 10,718,381	V51A	possibly damaging	Het
Mmrn1	G	A	6: 60,944,847	S96N	probably benign	Het
Mrc2	G	A	11: 105,348,431		probably null	Het
Msh3	C	A	13: 92,354,858	G15C	probably damaging	Het
Myl12b	C	A	17: 70,974,485	E120*	probably null	Het
Myo3a	T	G	2: 22,565,109		probably benign	Het
Nagk	A	T	6: 83,801,157	H245L	possibly damaging	Het
Nlrc5	A	G	8: 94,511,301		probably benign	Het
Ogfrl1	G	A	1: 23,369,960	T395I	probably benign	Het
Polr1b	T	A	2: 129,119,107	F662Y	possibly damaging	Het
Rrbp1	T	C	2: 143,989,558	K230E	probably damaging	Het
Skap2	C	T	6: 51,909,299		probably null	Het
Skint5	A	T	4: 113,940,741	M215K	probably damaging	Het
Slc17a4	C	T	13: 23,901,769	R387H	probably benign	Het
Tdp1	A	G	12: 99,894,708		probably null	Het
Tlr3	G	A	8: 45,396,939	L898F	probably damaging	Het
Tmem210	A	G	2: 25,288,432	E35G	possibly damaging	Het
Tpbg	T	C	9: 85,843,114		probably benign	Het
Tubb2a	G	T	13: 34,075,311	N165K	probably benign	Het
Usp14	A	G	18: 10,024,532		probably null	Het
Vmn1r33	A	T	6: 66,611,717	D284E	possibly damaging	Het
Wnk1	T	C	6: 119,950,043	E1265G	probably damaging	Het
Yme1l1	A	T	2: 23,191,080	T455S	possibly damaging	Het
Zfp111	T	C	7: 24,199,466	N241S	possibly damaging	Het

Other mutations in Nap1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01154:Nap1l1	APN	10	111486675	missense	probably damaging	0.98
IGL01453:Nap1l1	APN	10	111492978	missense	probably benign	0.09
IGL01734:Nap1l1	APN	10	111492899	missense	probably benign	0.26
IGL01843:Nap1l1	APN	10	111492911	missense	possibly damaging	0.93
PIT1430001:Nap1l1	UTSW	10	111486736	missense	probably damaging	1.00
PIT4131001:Nap1l1	UTSW	10	111486722	missense	probably null
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0020:Nap1l1	UTSW	10	111491023	missense	probably benign	0.01
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0131:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0132:Nap1l1	UTSW	10	111485509	missense	probably benign	0.17
R0601:Nap1l1	UTSW	10	111490363	splice site	probably benign
R1576:Nap1l1	UTSW	10	111494820	missense	probably damaging	1.00
R1619:Nap1l1	UTSW	10	111493379	missense	possibly damaging	0.77
R1969:Nap1l1	UTSW	10	111491053	missense	probably benign	0.03
R2071:Nap1l1	UTSW	10	111492900	missense	possibly damaging	0.46
R2383:Nap1l1	UTSW	10	111493411	missense	probably damaging	1.00
R3836:Nap1l1	UTSW	10	111495322	splice site	probably null
R3838:Nap1l1	UTSW	10	111495322	splice site	probably null
R3839:Nap1l1	UTSW	10	111495322	splice site	probably null
R4084:Nap1l1	UTSW	10	111490077	missense	possibly damaging	0.92
R4609:Nap1l1	UTSW	10	111492880	nonsense	probably null
R4985:Nap1l1	UTSW	10	111490083	missense	probably benign	0.01
R5906:Nap1l1	UTSW	10	111491030	nonsense	probably null
R5982:Nap1l1	UTSW	10	111495368	missense	possibly damaging	0.71
R6522:Nap1l1	UTSW	10	111494223	missense	probably damaging	0.99
R6868:Nap1l1	UTSW	10	111494808	missense	probably damaging	1.00
R7134:Nap1l1	UTSW	10	111494794	critical splice acceptor site	probably null
R7202:Nap1l1	UTSW	10	111491103	missense	probably damaging	1.00
R7789:Nap1l1	UTSW	10	111490456	missense	probably benign	0.01
R7950:Nap1l1	UTSW	10	111492908	missense	probably damaging	1.00
R8404:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8502:Nap1l1	UTSW	10	111481301	start codon destroyed	probably null	0.53
R8933:Nap1l1	UTSW	10	111492849	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CGTTGGCTGCAGTAAATCTTTTC -3'
(R):5'- CCTTTGTGTGGAAAACAATCTAAGC -3'

Sequencing Primer
(F):5'- AAAGCTGTCTGGATGTCTCAAG -3'
(R):5'- TGTGTGGAAAACAATCTAAGCAACAG -3'

Posted On

2015-04-06