Incidental Mutation 'R3837:Cdc20b'
ID275716
Institutional Source Beutler Lab
Gene Symbol Cdc20b
Ensembl Gene ENSMUSG00000078926
Gene Namecell division cycle 20B
SynonymsEG622422, EG238896
MMRRC Submission 040778-MU
Accession Numbers

Genbank: XM_138861

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3837 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location113035111-113091195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113084008 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 432 (W432R)
Ref Sequence ENSEMBL: ENSMUSP00000137849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568]
Predicted Effect probably damaging
Transcript: ENSMUST00000109244
AA Change: W474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926
AA Change: W474R

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181117
AA Change: W474R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926
AA Change: W474R

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181568
AA Change: W432R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926
AA Change: W432R

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232584
Meta Mutation Damage Score 0.9060 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
4930474N05Rik G A 14: 36,095,478 G112S probably benign Het
Adam24 T C 8: 40,680,545 S351P probably benign Het
Amigo2 T C 15: 97,245,315 I409V probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Col28a1 C T 6: 8,014,601 V935M possibly damaging Het
Col6a3 T C 1: 90,780,081 N1948D unknown Het
Dnajb2 G A 1: 75,241,480 probably null Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Fam35a A G 14: 34,249,185 V581A probably damaging Het
Fn1 A T 1: 71,653,155 probably null Het
Fryl T C 5: 73,071,265 T1708A probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm11562 A G 11: 99,620,200 I58T possibly damaging Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn2 T C 2: 31,413,407 L3020P probably damaging Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Lamtor1 T C 7: 101,910,108 probably null Het
Lrrd1 A T 5: 3,850,204 I170L possibly damaging Het
Magi2 G A 5: 20,215,468 D301N probably benign Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Mmrn1 G A 6: 60,944,847 S96N probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Msh3 C A 13: 92,354,858 G15C probably damaging Het
Myl12b C A 17: 70,974,485 E120* probably null Het
Myo3a T G 2: 22,565,109 probably benign Het
Nagk A T 6: 83,801,157 H245L possibly damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Nlrc5 A G 8: 94,511,301 probably benign Het
Ogfrl1 G A 1: 23,369,960 T395I probably benign Het
Polr1b T A 2: 129,119,107 F662Y possibly damaging Het
Rrbp1 T C 2: 143,989,558 K230E probably damaging Het
Skap2 C T 6: 51,909,299 probably null Het
Skint5 A T 4: 113,940,741 M215K probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Tdp1 A G 12: 99,894,708 probably null Het
Tlr3 G A 8: 45,396,939 L898F probably damaging Het
Tmem210 A G 2: 25,288,432 E35G possibly damaging Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn1r33 A T 6: 66,611,717 D284E possibly damaging Het
Wnk1 T C 6: 119,950,043 E1265G probably damaging Het
Yme1l1 A T 2: 23,191,080 T455S possibly damaging Het
Zfp111 T C 7: 24,199,466 N241S possibly damaging Het
Other mutations in Cdc20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Cdc20b APN 13 113059785 missense possibly damaging 0.74
IGL02603:Cdc20b APN 13 113078755 missense possibly damaging 0.88
IGL02663:Cdc20b APN 13 113056131 critical splice donor site probably null
IGL03024:Cdc20b APN 13 113091042 missense possibly damaging 0.58
IGL03379:Cdc20b APN 13 113081202 missense probably damaging 1.00
H8930:Cdc20b UTSW 13 113083966 missense probably damaging 1.00
R0207:Cdc20b UTSW 13 113078612 missense probably damaging 1.00
R0347:Cdc20b UTSW 13 113059827 missense probably damaging 0.97
R0448:Cdc20b UTSW 13 113078657 missense probably damaging 1.00
R0499:Cdc20b UTSW 13 113055950 missense probably benign 0.00
R1573:Cdc20b UTSW 13 113055944 missense probably benign 0.26
R1651:Cdc20b UTSW 13 113078724 nonsense probably null
R1786:Cdc20b UTSW 13 113081134 missense probably damaging 1.00
R1929:Cdc20b UTSW 13 113071917 missense probably benign 0.07
R2118:Cdc20b UTSW 13 113078698 missense probably benign 0.30
R3436:Cdc20b UTSW 13 113078699 missense probably damaging 0.99
R3508:Cdc20b UTSW 13 113081042 missense possibly damaging 0.80
R4050:Cdc20b UTSW 13 113064285 missense probably benign
R4521:Cdc20b UTSW 13 113081191 missense probably damaging 1.00
R4786:Cdc20b UTSW 13 113078734 missense probably damaging 1.00
R6079:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
R6610:Cdc20b UTSW 13 113064262 missense probably benign 0.02
R6814:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6872:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6887:Cdc20b UTSW 13 113078653 missense possibly damaging 0.88
R7144:Cdc20b UTSW 13 113083371 missense probably benign 0.36
R7770:Cdc20b UTSW 13 113078659 missense probably benign 0.01
U15987:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
X0064:Cdc20b UTSW 13 113059742 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGGAAGCCTTGGGATGAATCC -3'
(R):5'- ACTGCCAAAGATTGCTGCTG -3'

Sequencing Primer
(F):5'- CTCACTGAGGCTGGAGGATG -3'
(R):5'- AGATTGCTGCTGCCTAAAGC -3'
Posted On2015-04-06