Incidental Mutation 'R3848:Sell'
ID275733
Institutional Source Beutler Lab
Gene Symbol Sell
Ensembl Gene ENSMUSG00000026581
Gene Nameselectin, lymphocyte
SynonymsLyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164061982-164084181 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 164065661 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 149 (K149*)
Ref Sequence ENSEMBL: ENSMUSP00000142237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027871] [ENSMUST00000097491] [ENSMUST00000192047] [ENSMUST00000195358]
Predicted Effect probably null
Transcript: ENSMUST00000027871
AA Change: K149*
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581
AA Change: K149*

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097491
AA Change: K149*
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581
AA Change: K149*

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000192047
AA Change: K149*
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581
AA Change: K149*

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195358
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Sell
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum UTSW 1 164066201 unclassified probably null
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 unclassified probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4671:Sell UTSW 1 164065473 missense probably damaging 1.00
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R5112:Sell UTSW 1 164065318 missense possibly damaging 0.75
R6549:Sell UTSW 1 164065629 missense probably damaging 1.00
R7148:Sell UTSW 1 164065607 missense possibly damaging 0.85
R7545:Sell UTSW 1 164065334 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTAGTCGCCATACAAAACAAGAGAG -3'
(R):5'- TTGTGTACCTGCAGATTGCC -3'

Sequencing Primer
(F):5'- AAGCCCTTATTACTACTGGATAGG -3'
(R):5'- CCCAGAGGTGCTATGCTTAAG -3'
Posted On2015-04-06