Incidental Mutation 'R3848:Ugcg'
ID275752
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
congee UTSW 4 59207798 missense probably benign 0.17
Porridge UTSW 4 59219530 missense possibly damaging 0.86
slop UTSW 4 59211883 missense probably benign 0.16
wheatina UTSW 4 59220272 missense probably damaging 0.96
PIT4382001:Ugcg UTSW 4 59213246 missense possibly damaging 0.68
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
R7194:Ugcg UTSW 4 59213210 missense probably damaging 0.99
R7286:Ugcg UTSW 4 59217111 missense possibly damaging 0.95
R7362:Ugcg UTSW 4 59217109 missense probably damaging 1.00
R7472:Ugcg UTSW 4 59217156 missense probably benign
R7638:Ugcg UTSW 4 59220299 missense probably benign 0.26
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTTGCTCCTGGTTCTTGTGTTT -3'
(R):5'- AGGCTAGGCTGTTTTCACAATCA -3'

Sequencing Primer
(F):5'- TCTAACCCAACTCTGTTCAG -3'
(R):5'- CACGTATTCTTTCATTCCCC -3'
Posted On2015-04-06