Incidental Mutation 'R3848:Slc6a5'
ID275756
Institutional Source Beutler Lab
Gene Symbol Slc6a5
Ensembl Gene ENSMUSG00000039728
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 5
SynonymsGlyt2
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49910146-49963856 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to G at 49927558 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056442] [ENSMUST00000107605] [ENSMUST00000207753] [ENSMUST00000209172]
Predicted Effect probably benign
Transcript: ENSMUST00000056442
SMART Domains Protein: ENSMUSP00000058699
Gene: ENSMUSG00000039728

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107605
SMART Domains Protein: ENSMUSP00000103230
Gene: ENSMUSG00000039728

DomainStartEndE-ValueType
Pfam:SNF 185 734 1.6e-218 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207753
Predicted Effect probably benign
Transcript: ENSMUST00000209172
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium- and chloride-dependent glycine neurotransmitter transporter. This integral membrane glycoprotein is responsible for the clearance of extracellular glycine during glycine-mediated neurotransmission. This protein is found in glycinergic axons and maintains a high presynaptic pool of neurotransmitter at glycinergic synapses. Mutations in this gene cause hyperekplexia; a heterogenous neurological disorder characterized by exaggerated startle responses and neonatal apnea. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutant mice appear normal at birth but develop a complex neuromotor phenotype involving tremors, rigidity, and an impaired righting ability. Mutant mice die approximately 2 weeks after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Slc6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Slc6a5 APN 7 49917733 missense probably benign 0.35
IGL01821:Slc6a5 APN 7 49914853 intron probably benign
R0084:Slc6a5 UTSW 7 49930013 missense probably benign 0.01
R0266:Slc6a5 UTSW 7 49938408 splice site probably benign
R0411:Slc6a5 UTSW 7 49911791 missense probably damaging 1.00
R0621:Slc6a5 UTSW 7 49917365 splice site probably null
R1649:Slc6a5 UTSW 7 49936262 missense probably damaging 1.00
R1822:Slc6a5 UTSW 7 49956425 missense probably benign 0.00
R1889:Slc6a5 UTSW 7 49951434 missense probably benign 0.03
R2084:Slc6a5 UTSW 7 49948254 missense probably benign 0.14
R2098:Slc6a5 UTSW 7 49945567 missense probably damaging 1.00
R2365:Slc6a5 UTSW 7 49946536 missense possibly damaging 0.93
R2516:Slc6a5 UTSW 7 49956462 missense probably benign 0.00
R3622:Slc6a5 UTSW 7 49917623 missense probably benign 0.16
R3752:Slc6a5 UTSW 7 49936314 critical splice donor site probably null
R3917:Slc6a5 UTSW 7 49911869 missense probably damaging 1.00
R4617:Slc6a5 UTSW 7 49912020 missense probably benign 0.00
R4663:Slc6a5 UTSW 7 49938398 nonsense probably null
R4757:Slc6a5 UTSW 7 49959282 missense probably benign 0.15
R4916:Slc6a5 UTSW 7 49948256 missense probably benign 0.00
R5183:Slc6a5 UTSW 7 49936209 missense probably damaging 0.97
R5257:Slc6a5 UTSW 7 49929992 missense probably damaging 0.98
R5512:Slc6a5 UTSW 7 49941825 missense probably damaging 1.00
R5537:Slc6a5 UTSW 7 49959311 missense probably benign 0.03
R5558:Slc6a5 UTSW 7 49927573 missense probably benign
R5627:Slc6a5 UTSW 7 49911774 missense possibly damaging 0.85
R5655:Slc6a5 UTSW 7 49956470 missense probably benign
R5720:Slc6a5 UTSW 7 49956516 missense possibly damaging 0.86
R5736:Slc6a5 UTSW 7 49959354 missense probably benign 0.03
R5817:Slc6a5 UTSW 7 49956491 missense probably benign 0.00
R5879:Slc6a5 UTSW 7 49945512 missense probably damaging 1.00
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6033:Slc6a5 UTSW 7 49959351 missense probably benign 0.01
R6072:Slc6a5 UTSW 7 49912195 missense probably damaging 1.00
R6157:Slc6a5 UTSW 7 49951502 missense probably benign 0.03
R6172:Slc6a5 UTSW 7 49948333 nonsense probably null
R6414:Slc6a5 UTSW 7 49910243 unclassified probably benign
R7348:Slc6a5 UTSW 7 49910167 unclassified probably benign
R7381:Slc6a5 UTSW 7 49930056 missense probably damaging 1.00
R7486:Slc6a5 UTSW 7 49917330 missense possibly damaging 0.81
R7624:Slc6a5 UTSW 7 49941866 missense probably benign 0.00
R7735:Slc6a5 UTSW 7 49948342 critical splice donor site probably null
R7760:Slc6a5 UTSW 7 49946617 missense probably benign 0.03
Z1088:Slc6a5 UTSW 7 49911857 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GTACAAGGTATTGCAGGGCTGG -3'
(R):5'- CTGGCATCAGCAAGGAGAGTAC -3'

Sequencing Primer
(F):5'- TATTGCAGGGCTGGAGAATGC -3'
(R):5'- CATCTTCTGGGCTTGCTTACAGAG -3'
Posted On2015-04-06