Incidental Mutation 'R3848:Kif1bp'
ID275772
Institutional Source Beutler Lab
Gene Symbol Kif1bp
Ensembl Gene ENSMUSG00000036955
Gene NameKIF1 binding protein
Synonyms2510003E04Rik
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62538626-62578457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62569470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 64 (Y64H)
Ref Sequence ENSEMBL: ENSMUSP00000125236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065887] [ENSMUST00000159704] [ENSMUST00000162525] [ENSMUST00000162648] [ENSMUST00000162759]
Predicted Effect probably damaging
Transcript: ENSMUST00000065887
AA Change: Y256H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065160
Gene: ENSMUSG00000036955
AA Change: Y256H

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 243 610 6.6e-124 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159704
AA Change: Y256H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134770
Gene: ENSMUSG00000036955
AA Change: Y256H

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 383 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160228
Predicted Effect probably damaging
Transcript: ENSMUST00000162525
AA Change: Y256H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125162
Gene: ENSMUSG00000036955
AA Change: Y256H

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 6e-6 BLAST
Pfam:KBP_C 242 293 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162648
Predicted Effect probably damaging
Transcript: ENSMUST00000162759
AA Change: Y64H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125236
Gene: ENSMUSG00000036955
AA Change: Y64H

DomainStartEndE-ValueType
low complexity region 39 84 N/A INTRINSIC
Blast:TPR 204 235 1e-5 BLAST
Pfam:KBP_C 242 329 4.8e-28 PFAM
transmembrane domain 340 362 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208223
Meta Mutation Damage Score 0.9039 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin family member 1 binding protein that is characterized by two tetratrico peptide repeats. The encoded protein localizes to the mitochondria and may be involved in regulating transport of the mitochondria. Mutations in this gene are associated with Goldberg-Shprintzen megacolon syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous KO mice die shortly after birth from respiratory failure. Knockout affects innervation of the digestive tract, and the development of the olfactory bulb and the anterior commissure in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Kif1bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Kif1bp APN 10 62559339 nonsense probably null
IGL02127:Kif1bp APN 10 62578349 missense probably benign 0.00
IGL03304:Kif1bp APN 10 62559303 missense probably damaging 1.00
IGL02980:Kif1bp UTSW 10 62559168 missense probably damaging 1.00
R0317:Kif1bp UTSW 10 62578082 unclassified probably null
R0408:Kif1bp UTSW 10 62566053 missense probably benign 0.37
R0462:Kif1bp UTSW 10 62559456 missense probably damaging 1.00
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1469:Kif1bp UTSW 10 62559450 missense probably damaging 0.96
R1503:Kif1bp UTSW 10 62559408 missense probably damaging 0.98
R1830:Kif1bp UTSW 10 62559327 missense probably damaging 1.00
R4486:Kif1bp UTSW 10 62563027 intron probably benign
R4488:Kif1bp UTSW 10 62563027 intron probably benign
R4489:Kif1bp UTSW 10 62563027 intron probably benign
R5137:Kif1bp UTSW 10 62578241 missense probably damaging 1.00
R5193:Kif1bp UTSW 10 62559396 missense possibly damaging 0.81
R5212:Kif1bp UTSW 10 62563129 intron probably benign
R5929:Kif1bp UTSW 10 62559402 missense probably damaging 1.00
R6179:Kif1bp UTSW 10 62563250 nonsense probably null
R6488:Kif1bp UTSW 10 62559658 intron probably null
R6513:Kif1bp UTSW 10 62575034 intron probably null
R6808:Kif1bp UTSW 10 62575144 missense possibly damaging 0.90
R6900:Kif1bp UTSW 10 62559129 missense probably damaging 1.00
R6916:Kif1bp UTSW 10 62566064 missense probably benign 0.05
R7092:Kif1bp UTSW 10 62578300 missense probably damaging 1.00
R7289:Kif1bp UTSW 10 62566116 missense probably damaging 1.00
R7376:Kif1bp UTSW 10 62559064 missense possibly damaging 0.89
R7672:Kif1bp UTSW 10 62578073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACCAGAACACTGCATGAAATTC -3'
(R):5'- TAAGGGCCATGTGCAACAC -3'

Sequencing Primer
(F):5'- CAGAACACTGCATGAAATTCTCAATG -3'
(R):5'- GAAATGTTCGAGAAGGCC -3'
Posted On2015-04-06