Incidental Mutation 'R3848:Rapgef6'
ID 275774
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene Name Rap guanine nucleotide exchange factor (GEF) 6
Synonyms PDZ-GEF2, C030018K18Rik, Pdzgef2, RA-GEF-2
MMRRC Submission 040896-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3848 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 54413673-54590111 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54582134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1349 (S1349P)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
AlphaFold Q5NCJ1
Predicted Effect probably benign
Transcript: ENSMUST00000094536
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: S1357P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: S1357P

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: S1349P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: S1349P

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000207429
AA Change: S1354P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,336,783 (GRCm39) Q1564L probably damaging Het
Adgrv1 A G 13: 81,588,191 (GRCm39) V4465A probably damaging Het
Als2cl A G 9: 110,718,377 (GRCm39) probably benign Het
Anxa2 G T 9: 69,374,624 (GRCm39) D34Y probably damaging Het
Asic1 A G 15: 99,570,814 (GRCm39) N143S probably benign Het
Catsperb A C 12: 101,475,585 (GRCm39) Q376H probably damaging Het
Cd72 T C 4: 43,452,525 (GRCm39) E132G possibly damaging Het
Cdh16 T C 8: 105,344,473 (GRCm39) D22G possibly damaging Het
Cep170 G A 1: 176,583,409 (GRCm39) A990V probably benign Het
Col15a1 T C 4: 47,289,374 (GRCm39) V48A possibly damaging Het
Col3a1 C A 1: 45,361,150 (GRCm39) P112T unknown Het
Cpeb2 T G 5: 43,394,788 (GRCm39) S64A probably damaging Het
Cplx3 G A 9: 57,515,600 (GRCm39) A425V possibly damaging Het
Ctsc A G 7: 87,958,818 (GRCm39) H366R probably benign Het
Cul5 T G 9: 53,529,286 (GRCm39) M800L probably benign Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Efhb A T 17: 53,734,024 (GRCm39) probably benign Het
Fat4 T A 3: 39,061,410 (GRCm39) V4331D probably benign Het
Fbxl8 T C 8: 105,993,781 (GRCm39) S46P probably benign Het
Fbxo38 G A 18: 62,648,144 (GRCm39) S798F possibly damaging Het
Fggy T C 4: 95,489,361 (GRCm39) probably benign Het
Foxp4 A G 17: 48,186,453 (GRCm39) I442T unknown Het
Gm13941 T C 2: 110,935,198 (GRCm39) M11V unknown Het
Hoxd8 A G 2: 74,535,929 (GRCm39) Y13C possibly damaging Het
Hsf4 T C 8: 105,997,469 (GRCm39) F101L probably damaging Het
Jph2 G A 2: 163,181,332 (GRCm39) P611S probably benign Het
Kifbp A G 10: 62,405,249 (GRCm39) Y64H probably damaging Het
Kndc1 T C 7: 139,488,893 (GRCm39) S183P probably damaging Het
L3mbtl1 A G 2: 162,790,121 (GRCm39) E132G probably damaging Het
Lmo7 A G 14: 102,159,531 (GRCm39) probably null Het
Lrpprc T C 17: 85,078,355 (GRCm39) I308V probably benign Het
Mei1 T C 15: 81,997,218 (GRCm39) probably benign Het
Mki67 A C 7: 135,297,859 (GRCm39) S2392A probably benign Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Nek1 T A 8: 61,525,349 (GRCm39) F596I probably damaging Het
Or51v8 A G 7: 103,319,908 (GRCm39) V110A probably damaging Het
Or52e8b A G 7: 104,673,539 (GRCm39) V216A probably damaging Het
Or8u10 A T 2: 85,915,751 (GRCm39) Y123* probably null Het
Orc2 T C 1: 58,520,151 (GRCm39) T225A probably benign Het
P2ry1 G A 3: 60,910,880 (GRCm39) W6* probably null Het
Pam T A 1: 97,782,481 (GRCm39) probably benign Het
Pigt G A 2: 164,340,500 (GRCm39) probably benign Het
Pik3c2a A T 7: 115,963,785 (GRCm39) C71* probably null Het
Plcxd2 T C 16: 45,792,629 (GRCm39) T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 (GRCm39) K236E probably damaging Het
Ppargc1b T A 18: 61,444,113 (GRCm39) D350V probably damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Sell A T 1: 163,893,230 (GRCm39) K149* probably null Het
Sidt1 A G 16: 44,076,322 (GRCm39) probably benign Het
Slc6a5 C G 7: 49,577,306 (GRCm39) probably benign Het
Slc7a14 A T 3: 31,291,623 (GRCm39) N218K probably damaging Het
Spice1 C T 16: 44,199,254 (GRCm39) R569* probably null Het
Stk35 G T 2: 129,642,656 (GRCm39) A66S probably benign Het
Tmem245 A G 4: 56,926,298 (GRCm39) probably benign Het
Tnxb A C 17: 34,909,369 (GRCm39) R1632S possibly damaging Het
Ttc6 G A 12: 57,723,932 (GRCm39) R1020H probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn2r105 A G 17: 20,428,952 (GRCm39) I708T possibly damaging Het
Vmn2r117 G T 17: 23,679,389 (GRCm39) H612N probably damaging Het
Vmn2r15 A T 5: 109,445,312 (GRCm39) D37E probably benign Het
Zbtb41 T A 1: 139,351,734 (GRCm39) H282Q probably benign Het
Zfp687 T C 3: 94,915,225 (GRCm39) D1092G probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54,570,091 (GRCm39) missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54,554,935 (GRCm39) nonsense probably null
IGL00809:Rapgef6 APN 11 54,540,126 (GRCm39) missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54,582,099 (GRCm39) missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54,510,844 (GRCm39) nonsense probably null
IGL01372:Rapgef6 APN 11 54,559,437 (GRCm39) splice site probably benign
IGL01604:Rapgef6 APN 11 54,585,389 (GRCm39) missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54,501,668 (GRCm39) missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54,443,695 (GRCm39) missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54,567,226 (GRCm39) missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54,567,181 (GRCm39) missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54,540,172 (GRCm39) unclassified probably benign
IGL02934:Rapgef6 APN 11 54,516,690 (GRCm39) missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54,516,793 (GRCm39) missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54,586,915 (GRCm39) missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54,548,255 (GRCm39) missense probably damaging 1.00
shocker UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54,559,572 (GRCm39) splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54,570,203 (GRCm39) missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54,582,446 (GRCm39) missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54,437,204 (GRCm39) missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54,516,701 (GRCm39) nonsense probably null
R0189:Rapgef6 UTSW 11 54,582,075 (GRCm39) missense probably benign
R0201:Rapgef6 UTSW 11 54,510,767 (GRCm39) missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54,516,789 (GRCm39) missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54,581,110 (GRCm39) missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54,559,503 (GRCm39) missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54,582,525 (GRCm39) missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54,517,534 (GRCm39) missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54,530,553 (GRCm39) splice site probably null
R1530:Rapgef6 UTSW 11 54,552,009 (GRCm39) missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1620:Rapgef6 UTSW 11 54,517,420 (GRCm39) missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1629:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1630:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1634:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1640:Rapgef6 UTSW 11 54,548,231 (GRCm39) missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54,582,458 (GRCm39) missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1743:Rapgef6 UTSW 11 54,567,110 (GRCm39) missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54,585,314 (GRCm39) missense probably benign
R1851:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54,533,637 (GRCm39) missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54,437,223 (GRCm39) frame shift probably null
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54,551,654 (GRCm39) missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54,548,089 (GRCm39) missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54,522,075 (GRCm39) missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54,559,512 (GRCm39) missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54,585,098 (GRCm39) missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54,533,582 (GRCm39) missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54,578,537 (GRCm39) missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54,552,001 (GRCm39) missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54,516,760 (GRCm39) missense probably benign 0.40
R4823:Rapgef6 UTSW 11 54,585,326 (GRCm39) missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54,526,989 (GRCm39) missense probably benign
R4906:Rapgef6 UTSW 11 54,443,662 (GRCm39) missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54,513,143 (GRCm39) missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54,548,143 (GRCm39) missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54,582,207 (GRCm39) missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54,413,943 (GRCm39) missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54,548,200 (GRCm39) missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54,526,962 (GRCm39) missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54,567,220 (GRCm39) missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54,559,470 (GRCm39) missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54,530,609 (GRCm39) missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54,510,842 (GRCm39) missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54,540,073 (GRCm39) missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54,517,164 (GRCm39) splice site probably null
R6293:Rapgef6 UTSW 11 54,525,607 (GRCm39) missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54,582,563 (GRCm39) missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54,437,206 (GRCm39) missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54,567,206 (GRCm39) missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54,548,191 (GRCm39) missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54,567,189 (GRCm39) missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54,437,252 (GRCm39) missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54,582,065 (GRCm39) missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54,501,747 (GRCm39) critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54,510,830 (GRCm39) missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54,526,997 (GRCm39) missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54,525,787 (GRCm39) missense unknown
R7646:Rapgef6 UTSW 11 54,516,780 (GRCm39) missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54,585,279 (GRCm39) missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54,551,901 (GRCm39) missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54,517,414 (GRCm39) missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54,585,225 (GRCm39) missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54,517,549 (GRCm39) missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54,516,784 (GRCm39) missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54,522,127 (GRCm39) nonsense probably null
R8393:Rapgef6 UTSW 11 54,578,487 (GRCm39) missense probably benign
R8465:Rapgef6 UTSW 11 54,582,308 (GRCm39) missense probably benign 0.00
R8492:Rapgef6 UTSW 11 54,581,063 (GRCm39) missense probably damaging 0.99
R8791:Rapgef6 UTSW 11 54,459,295 (GRCm39) missense probably benign 0.15
R8866:Rapgef6 UTSW 11 54,443,700 (GRCm39) critical splice donor site probably null
R8917:Rapgef6 UTSW 11 54,582,392 (GRCm39) nonsense probably null
R8921:Rapgef6 UTSW 11 54,570,065 (GRCm39) missense probably benign 0.09
R9031:Rapgef6 UTSW 11 54,578,667 (GRCm39) missense probably benign 0.00
R9093:Rapgef6 UTSW 11 54,487,912 (GRCm39) nonsense probably null
R9354:Rapgef6 UTSW 11 54,510,749 (GRCm39) missense possibly damaging 0.66
R9514:Rapgef6 UTSW 11 54,443,684 (GRCm39) missense probably benign 0.14
R9516:Rapgef6 UTSW 11 54,582,169 (GRCm39) missense probably damaging 1.00
R9739:Rapgef6 UTSW 11 54,513,189 (GRCm39) missense probably benign 0.03
R9789:Rapgef6 UTSW 11 54,540,097 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGATTTCTTAGAGGAAACATTGCC -3'
(R):5'- TGAGCAGCCTTTAGGACAGG -3'

Sequencing Primer
(F):5'- CTTAGAGGAAACATTGCCTAGCTAAG -3'
(R):5'- CAGCCTTTAGGACAGGCACAG -3'
Posted On 2015-04-06