Incidental Mutation 'R3848:Asic1'
ID275783
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99672933 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 143 (N143S)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
AA Change: N143S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: N143S

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Efhb A T 17: 53,426,996 probably benign Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCATGTGTCAGGCTCTC -3'
(R):5'- TCTAGAGACCAGGGTGATGG -3'

Sequencing Primer
(F):5'- AGGCTCTCCTGGCATACTCAG -3'
(R):5'- GGGGGCTCCATACCGGG -3'
Posted On2015-04-06