Incidental Mutation 'R3848:Efhb'
ID275791
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
MMRRC Submission 040896-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3848 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 53426996 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect probably benign
Transcript: ENSMUST00000024725
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Adgrv1 A G 13: 81,440,072 V4465A probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Anxa2 G T 9: 69,467,342 D34Y probably damaging Het
Asic1 A G 15: 99,672,933 N143S probably benign Het
Catsperb A C 12: 101,509,326 Q376H probably damaging Het
Cd72 T C 4: 43,452,525 E132G possibly damaging Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Col15a1 T C 4: 47,289,374 V48A possibly damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpeb2 T G 5: 43,237,445 S64A probably damaging Het
Ctsc A G 7: 88,309,610 H366R probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Fbxo38 G A 18: 62,515,073 S798F possibly damaging Het
Fggy T C 4: 95,601,124 probably benign Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gm13941 T C 2: 111,104,853 M11V unknown Het
Hoxd8 A G 2: 74,705,585 Y13C possibly damaging Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Jph2 G A 2: 163,339,412 P611S probably benign Het
Kif1bp A G 10: 62,569,470 Y64H probably damaging Het
Kndc1 T C 7: 139,908,977 S183P probably damaging Het
L3mbtl1 A G 2: 162,948,201 E132G probably damaging Het
Lman1l G A 9: 57,608,317 A425V possibly damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrpprc T C 17: 84,770,927 I308V probably benign Het
Mei1 T C 15: 82,113,017 probably benign Het
Mki67 A C 7: 135,696,130 S2392A probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Olfr1037 A T 2: 86,085,407 Y123* probably null Het
Olfr624 A G 7: 103,670,701 V110A probably damaging Het
Olfr675 A G 7: 105,024,332 V216A probably damaging Het
Orc2 T C 1: 58,480,992 T225A probably benign Het
P2ry1 G A 3: 61,003,459 W6* probably null Het
Pam T A 1: 97,854,756 probably benign Het
Pigt G A 2: 164,498,580 probably benign Het
Pik3c2a A T 7: 116,364,550 C71* probably null Het
Plcxd2 T C 16: 45,972,266 T237A probably damaging Het
Pnrc1 T C 4: 33,246,252 K236E probably damaging Het
Ppargc1b T A 18: 61,311,042 D350V probably damaging Het
Rapgef6 T C 11: 54,691,308 S1349P probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Sell A T 1: 164,065,661 K149* probably null Het
Sidt1 A G 16: 44,255,959 probably benign Het
Slc6a5 C G 7: 49,927,558 probably benign Het
Slc7a14 A T 3: 31,237,474 N218K probably damaging Het
Spice1 C T 16: 44,378,891 R569* probably null Het
Stk35 G T 2: 129,800,736 A66S probably benign Het
Tmem245 A G 4: 56,926,298 probably benign Het
Tnxb A C 17: 34,690,395 R1632S possibly damaging Het
Ttc6 G A 12: 57,677,146 R1020H probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r105 A G 17: 20,208,690 I708T possibly damaging Het
Vmn2r117 G T 17: 23,460,415 H612N probably damaging Het
Vmn2r15 A T 5: 109,297,446 D37E probably benign Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2085:Efhb UTSW 17 53426909 critical splice donor site probably null
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R2415:Efhb UTSW 17 53463096 missense probably benign 0.01
R3858:Efhb UTSW 17 53462780 missense possibly damaging 0.61
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8044:Efhb UTSW 17 53399115 missense probably benign 0.41
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
R8882:Efhb UTSW 17 53462684 missense probably damaging 1.00
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATTTGGTAAGACACAACCCAACATTTG -3'
(R):5'- TCCATTATAATGCATGTGACAGAAG -3'

Sequencing Primer
(F):5'- TGCTTCCCAGGACTAAGATTGCAG -3'
(R):5'- CATGTGACAGAAGCATCAATATGTGC -3'
Posted On2015-04-06