Incidental Mutation 'R3849:Kif24'
ID275803
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Namekinesin family member 24
Synonyms4933425J19Rik
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41390745-41464887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41404734 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 422 (R422H)
Ref Sequence ENSEMBL: ENSMUSP00000103690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055]
Predicted Effect probably damaging
Transcript: ENSMUST00000030148
AA Change: R288H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: R288H

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108055
AA Change: R422H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: R422H

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141951
Meta Mutation Damage Score 0.9347 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41413826 splice site probably null
IGL00787:Kif24 APN 4 41397583 missense probably damaging 1.00
IGL01065:Kif24 APN 4 41423639 unclassified probably benign
IGL01716:Kif24 APN 4 41393454 missense probably benign 0.40
IGL01796:Kif24 APN 4 41392978 unclassified probably benign
IGL02307:Kif24 APN 4 41395274 missense probably benign 0.02
IGL03061:Kif24 APN 4 41394323 missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41394417 missense probably benign 0.12
IGL03100:Kif24 APN 4 41394446 missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41414939 nonsense probably null
R0345:Kif24 UTSW 4 41428413 missense probably benign 0.01
R0365:Kif24 UTSW 4 41428731 missense probably benign 0.06
R0366:Kif24 UTSW 4 41428717 missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41393706 missense probably damaging 0.97
R0682:Kif24 UTSW 4 41428620 missense probably benign 0.01
R1611:Kif24 UTSW 4 41423552 missense probably benign 0.02
R1634:Kif24 UTSW 4 41393529 missense probably benign 0.02
R1772:Kif24 UTSW 4 41409787 missense probably damaging 1.00
R1997:Kif24 UTSW 4 41392904 missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41395064 missense probably damaging 1.00
R4356:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4357:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4358:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4359:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4406:Kif24 UTSW 4 41393954 missense probably damaging 1.00
R4580:Kif24 UTSW 4 41395287 missense probably damaging 1.00
R4756:Kif24 UTSW 4 41397545 critical splice donor site probably null
R4921:Kif24 UTSW 4 41394329 missense probably damaging 0.99
R4935:Kif24 UTSW 4 41394939 missense probably damaging 0.99
R5288:Kif24 UTSW 4 41395373 missense probably benign 0.09
R5398:Kif24 UTSW 4 41394401 missense possibly damaging 0.50
R5885:Kif24 UTSW 4 41423463 missense probably damaging 1.00
R5901:Kif24 UTSW 4 41428604 missense probably damaging 1.00
R5919:Kif24 UTSW 4 41394477 missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41428670 nonsense probably null
R6278:Kif24 UTSW 4 41423498 missense probably damaging 1.00
R6291:Kif24 UTSW 4 41413959 missense probably damaging 1.00
R6891:Kif24 UTSW 4 41394168 missense probably benign 0.33
R7178:Kif24 UTSW 4 41395085 missense probably benign 0.00
R7437:Kif24 UTSW 4 41404687 missense possibly damaging 0.70
R7453:Kif24 UTSW 4 41394673 missense possibly damaging 0.91
R7543:Kif24 UTSW 4 41413993 nonsense probably null
R7548:Kif24 UTSW 4 41423601 missense possibly damaging 0.57
Z1088:Kif24 UTSW 4 41395091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCCCTGCAATGAAGAGCC -3'
(R):5'- CTCTTTATGACTTAGTGTCTGGGCC -3'

Sequencing Primer
(F):5'- CCTGCAATGAAGAGCCAAGGTG -3'
(R):5'- CTGGCCATCAGAAAGTGCAGTATTC -3'
Posted On2015-04-06