Incidental Mutation 'R3849:Gp9'
ID275810
Institutional Source Beutler Lab
Gene Symbol Gp9
Ensembl Gene ENSMUSG00000030054
Gene Nameglycoprotein 9 (platelet)
SynonymsGPIX, Cd42
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87778072-87779768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87779151 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 49 (I49M)
Ref Sequence ENSEMBL: ENSMUSP00000032133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032133]
Predicted Effect probably benign
Transcript: ENSMUST00000032133
AA Change: I49M

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032133
Gene: ENSMUSG00000030054
AA Change: I49M

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LRRNT 19 55 2.84e-9 SMART
LRRCT 85 136 4.22e-9 SMART
transmembrane domain 147 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204945
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small membrane glycoprotein found on the surface of human platelets. It forms a 1-to-1 noncovalent complex with glycoprotein Ib, a platelet surface membrane glycoprotein complex that functions as a receptor for von Willebrand factor. The complete receptor complex includes noncovalent association of the alpha and beta subunits with the protein encoded by this gene and platelet glycoprotein V. Defects in this gene are a cause of Bernard-Soulier syndrome, also known as giant platelet disease. These patients have unusually large platelets and have a clinical bleeding tendency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Gp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Gp9 APN 6 87779433 missense probably damaging 1.00
R2173:Gp9 UTSW 6 87779053 missense probably benign 0.05
R3778:Gp9 UTSW 6 87779005 start codon destroyed probably benign 0.00
R3847:Gp9 UTSW 6 87779151 missense probably benign 0.08
R4936:Gp9 UTSW 6 87779247 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCATAGGTATCCTGGCAC -3'
(R):5'- TACACATGCATTAGGGCCTCG -3'

Sequencing Primer
(F):5'- GCTGACAAGCGTTAATCTCATTGC -3'
(R):5'- TCGGGCATGTGGTCCTC -3'
Posted On2015-04-06