Incidental Mutation 'R3849:Tead2'
ID275814
Institutional Source Beutler Lab
Gene Symbol Tead2
Ensembl Gene ENSMUSG00000030796
Gene NameTEA domain family member 2
SynonymsTEAD-2, TEF-4, Etdf
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3849 (G1)
Quality Score185
Status Validated
Chromosome7
Chromosomal Location45215753-45233644 bp(+) (GRCm38)
Type of Mutationunclassified (1842 bp from exon)
DNA Base Change (assembly) T to A at 45232328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000033063] [ENSMUST00000097216] [ENSMUST00000098461] [ENSMUST00000107801] [ENSMUST00000209343] [ENSMUST00000209478] [ENSMUST00000209779] [ENSMUST00000210078] [ENSMUST00000210226] [ENSMUST00000211373]
Predicted Effect probably damaging
Transcript: ENSMUST00000033060
AA Change: I406N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796
AA Change: I406N

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably null
Transcript: ENSMUST00000033063
SMART Domains Protein: ENSMUSP00000033063
Gene: ENSMUSG00000030798

DomainStartEndE-ValueType
Pfam:Tetraspannin 31 292 9.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097216
AA Change: I371N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796
AA Change: I371N

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098461
SMART Domains Protein: ENSMUSP00000096061
Gene: ENSMUSG00000030798

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 270 3.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107801
AA Change: I406N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796
AA Change: I406N

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143734
AA Change: S61T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209222
Predicted Effect probably benign
Transcript: ENSMUST00000209343
Predicted Effect probably damaging
Transcript: ENSMUST00000209478
AA Change: I90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209677
Predicted Effect probably null
Transcript: ENSMUST00000209779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210000
Predicted Effect probably null
Transcript: ENSMUST00000210078
Predicted Effect probably benign
Transcript: ENSMUST00000210226
Predicted Effect probably null
Transcript: ENSMUST00000211373
Meta Mutation Damage Score 0.9519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a functionally null allele of this gene exhibit no gross abnormalities and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Tead2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Tead2 APN 7 45217251 missense probably damaging 0.96
IGL01887:Tead2 APN 7 45232310 missense probably damaging 1.00
IGL02378:Tead2 APN 7 45218147 critical splice donor site probably null
IGL02441:Tead2 APN 7 45217421 missense probably damaging 1.00
IGL02716:Tead2 APN 7 45232296 nonsense probably null
IGL02939:Tead2 APN 7 45220434 splice site probably benign
IGL03302:Tead2 APN 7 45232899 missense possibly damaging 0.86
R0325:Tead2 UTSW 7 45225755 missense probably damaging 1.00
R0611:Tead2 UTSW 7 45217250 missense probably damaging 0.99
R2571:Tead2 UTSW 7 45225770 missense probably damaging 1.00
R3401:Tead2 UTSW 7 45223673 unclassified probably benign
R3847:Tead2 UTSW 7 45232328 unclassified probably null
R3850:Tead2 UTSW 7 45232328 unclassified probably null
R5729:Tead2 UTSW 7 45220742 unclassified probably benign
R5932:Tead2 UTSW 7 45232899 missense probably benign 0.00
R5956:Tead2 UTSW 7 45220714 unclassified probably benign
R6208:Tead2 UTSW 7 45218102 missense probably damaging 1.00
R6729:Tead2 UTSW 7 45217234 missense probably benign
R7152:Tead2 UTSW 7 45220447 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TAAGGGTGAAGCTTCGGTCC -3'
(R):5'- CTTCTCAGAGAAGCCAGATGC -3'

Sequencing Primer
(F):5'- GTGGCCGTGATCTCTCTCAG -3'
(R):5'- GCTTAGAAGCCGAGGTATCTC -3'
Posted On2015-04-06