Incidental Mutation 'R3849:Adamts17'
ID275816
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
SynonymsAU023434
MMRRC Submission 040897-MU
Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R3849 (G1)
Quality Score88
Status Validated
Chromosome7
Chromosomal Location66839735-67153171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66840467 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 99 (L99Q)
Ref Sequence ENSEMBL: ENSMUSP00000095984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098382
AA Change: L99Q

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: L99Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107478
AA Change: L99Q

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: L99Q

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156396
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66968902 missense probably damaging 1.00
IGL00950:Adamts17 APN 7 67120912 missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66908601 missense probably damaging 1.00
IGL01591:Adamts17 APN 7 67004396 missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66888411 missense probably benign 0.29
IGL01640:Adamts17 APN 7 67029680 missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66840289 missense probably benign 0.06
IGL01747:Adamts17 APN 7 67052011 missense probably damaging 1.00
IGL02081:Adamts17 APN 7 67062110 missense probably damaging 1.00
IGL02152:Adamts17 APN 7 67125000 missense probably benign 0.01
IGL02264:Adamts17 APN 7 67047459 splice site probably null
IGL02457:Adamts17 APN 7 67027814 missense probably damaging 0.99
IGL02519:Adamts17 APN 7 67124973 missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66909376 missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66849878 splice site probably benign
IGL02711:Adamts17 APN 7 67052040 splice site probably benign
IGL03006:Adamts17 APN 7 67078347 missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 67062108 missense probably damaging 1.00
IGL03343:Adamts17 APN 7 67075316 missense probably damaging 1.00
E2594:Adamts17 UTSW 7 67004350 missense probably damaging 1.00
R0380:Adamts17 UTSW 7 67150044 missense probably benign 0.00
R0416:Adamts17 UTSW 7 66915898 splice site probably null
R0635:Adamts17 UTSW 7 66908605 missense probably damaging 1.00
R1083:Adamts17 UTSW 7 67147574 missense probably damaging 1.00
R1476:Adamts17 UTSW 7 67075343 missense probably damaging 1.00
R1728:Adamts17 UTSW 7 67149956 nonsense probably null
R1729:Adamts17 UTSW 7 67149956 nonsense probably null
R1763:Adamts17 UTSW 7 67147715 missense probably damaging 1.00
R1784:Adamts17 UTSW 7 67149956 nonsense probably null
R1905:Adamts17 UTSW 7 67047472 nonsense probably null
R1938:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3106:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66839914 splice site probably null
R3850:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3945:Adamts17 UTSW 7 67120939 missense probably benign
R4519:Adamts17 UTSW 7 66840566 missense probably damaging 0.99
R4554:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4555:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4556:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4557:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4700:Adamts17 UTSW 7 67041888 missense probably damaging 1.00
R4752:Adamts17 UTSW 7 67004470 missense probably damaging 0.96
R5019:Adamts17 UTSW 7 67062070 nonsense probably null
R5438:Adamts17 UTSW 7 66888417 missense probably benign 0.30
R5444:Adamts17 UTSW 7 67041899 missense probably benign 0.02
R5673:Adamts17 UTSW 7 67041807 missense probably damaging 1.00
R6326:Adamts17 UTSW 7 67120888 missense probably benign 0.05
R6964:Adamts17 UTSW 7 66909400 missense possibly damaging 0.93
R6964:Adamts17 UTSW 7 67004353 missense probably benign 0.00
R7129:Adamts17 UTSW 7 67121010 missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66840556 nonsense probably null
R7355:Adamts17 UTSW 7 67075304 missense
R7386:Adamts17 UTSW 7 66968849 missense probably benign 0.25
R7407:Adamts17 UTSW 7 67047556 nonsense probably null
R7432:Adamts17 UTSW 7 67051917 missense
R7782:Adamts17 UTSW 7 67125054 missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66909476 missense probably damaging 0.99
X0022:Adamts17 UTSW 7 67041901 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGAACTGGTCTCTGGTTCCCTC -3'
(R):5'- TCTCCTAGGAAGGCACAGTC -3'

Sequencing Primer
(F):5'- ATACCCACGGAGCCTTGC -3'
(R):5'- AAGGTAGGTCTTCTCCCGC -3'
Posted On2015-04-06