Incidental Mutation 'R3849:Grip1'
ID275827
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119929958 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 65 (G65D)
Ref Sequence ENSEMBL: ENSMUSP00000122323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]
Predicted Effect probably damaging
Transcript: ENSMUST00000041962
AA Change: G66D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: G66D

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077871
AA Change: G39D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813
AA Change: G39D

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105262
AA Change: G65D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: G65D

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127787
Predicted Effect probably damaging
Transcript: ENSMUST00000138410
AA Change: G65D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: G65D

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably benign
Transcript: ENSMUST00000144825
AA Change: G38D

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813
AA Change: G38D

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144959
AA Change: G65D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: G65D

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147356
AA Change: G66D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: G66D

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147454
AA Change: G65D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: G65D

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147598
Predicted Effect probably damaging
Transcript: ENSMUST00000148954
AA Change: G65D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: G65D

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Meta Mutation Damage Score 0.9269 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
R7768:Grip1 UTSW 10 120038397 missense probably damaging 0.98
R7831:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7896:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
R7914:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7979:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
RF011:Grip1 UTSW 10 119931315 missense probably null 0.97
Predicted Primers PCR Primer
(F):5'- CATCGCCAGATGCTGCAATTAC -3'
(R):5'- GCAGCTGTCATTTATTTATCAGTGACC -3'

Sequencing Primer
(F):5'- CTGCAATTACAATACAAGCTGAGGTC -3'
(R):5'- AGTTACCTGGCAGCGATT -3'
Posted On2015-04-06