Incidental Mutation 'R3849:Mtr'
ID275830
Institutional Source Beutler Lab
Gene Symbol Mtr
Ensembl Gene ENSMUSG00000021311
Gene Name5-methyltetrahydrofolate-homocysteine methyltransferase
Synonymsmethionine synthase, D830038K18Rik, MS
MMRRC Submission 040897-MU
Accession Numbers

Genbank: NM_001081128

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12182712-12258113 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12247365 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Ref Sequence ENSEMBL: ENSMUSP00000152579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099856] [ENSMUST00000221290]
Predicted Effect probably benign
Transcript: ENSMUST00000099856
AA Change: V175A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097442
Gene: ENSMUSG00000021311
AA Change: V175A

DomainStartEndE-ValueType
Pfam:S-methyl_trans 18 326 1.5e-93 PFAM
Pfam:Pterin_bind 363 601 4.6e-63 PFAM
B12-binding_2 657 743 6.42e-41 SMART
Pfam:B12-binding 761 861 3.3e-20 PFAM
Pfam:Met_synt_B12 953 1234 2.5e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221290
AA Change: S152P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 5-methyltetrahydrofolate-homocysteine methyltransferase. This enzyme, also known as cobalamin-dependent methionine synthase, catalyzes the final step in methionine biosynthesis. Mutations in MTR have been identified as the underlying cause of methylcobalamin deficiency complementation group G. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit embryonic lethality prior to E9.5. Heterozygous appear mostly similar to conrtols, except that they exhibit elevated plasma methionine and homocysteine levels. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Gene trapped(5)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Mtr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Mtr APN 13 12225650 splice site probably benign
IGL02456:Mtr APN 13 12199094 missense probably damaging 0.98
IGL02573:Mtr APN 13 12199127 missense possibly damaging 0.95
IGL02642:Mtr APN 13 12195232 splice site probably benign
IGL03005:Mtr APN 13 12235449 splice site probably benign
IGL03017:Mtr APN 13 12247891 critical splice donor site probably null
IGL03036:Mtr APN 13 12247377 missense probably damaging 1.00
H8930:Mtr UTSW 13 12235460 missense probably damaging 1.00
PIT4431001:Mtr UTSW 13 12212443 missense probably damaging 1.00
PIT4520001:Mtr UTSW 13 12197985 nonsense probably null
R0011:Mtr UTSW 13 12238052 splice site probably benign
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0047:Mtr UTSW 13 12222226 missense probably damaging 1.00
R0304:Mtr UTSW 13 12222154 critical splice donor site probably null
R0617:Mtr UTSW 13 12221432 missense probably benign
R0842:Mtr UTSW 13 12200247 missense probably damaging 1.00
R1101:Mtr UTSW 13 12189525 missense possibly damaging 0.84
R1450:Mtr UTSW 13 12193733 missense probably damaging 0.99
R1534:Mtr UTSW 13 12235544 splice site probably benign
R1907:Mtr UTSW 13 12225532 missense probably damaging 1.00
R2111:Mtr UTSW 13 12244601 missense possibly damaging 0.86
R2354:Mtr UTSW 13 12188157 splice site probably benign
R3899:Mtr UTSW 13 12216849 missense probably benign 0.00
R4012:Mtr UTSW 13 12189397 missense probably damaging 1.00
R4012:Mtr UTSW 13 12189398 missense probably damaging 1.00
R4075:Mtr UTSW 13 12215412 critical splice donor site probably null
R4091:Mtr UTSW 13 12231057 missense probably damaging 1.00
R4655:Mtr UTSW 13 12227793 missense probably damaging 1.00
R4801:Mtr UTSW 13 12195251 missense probably benign 0.01
R4802:Mtr UTSW 13 12195251 missense probably benign 0.01
R4895:Mtr UTSW 13 12216866 missense probably benign 0.01
R5481:Mtr UTSW 13 12188155 critical splice acceptor site probably null
R5966:Mtr UTSW 13 12215567 critical splice acceptor site probably null
R6209:Mtr UTSW 13 12190392 missense probably benign 0.00
R6348:Mtr UTSW 13 12247954 missense possibly damaging 0.49
R6463:Mtr UTSW 13 12216866 missense probably benign 0.01
R6467:Mtr UTSW 13 12188106 missense probably damaging 1.00
R7046:Mtr UTSW 13 12190209 missense possibly damaging 0.58
R7505:Mtr UTSW 13 12221476 missense probably benign 0.02
R7575:Mtr UTSW 13 12199077 missense probably benign 0.01
R7705:Mtr UTSW 13 12249896 missense probably benign
X0064:Mtr UTSW 13 12250657 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATATGTTTTCTAGACTCAGGTG -3'
(R):5'- ACATTGCATTTGGTTCCTGGC -3'

Sequencing Primer
(F):5'- TGGTGTCAGTCAGAGCCAGAC -3'
(R):5'- CTGGCGTGCTATCCACTGTG -3'
Posted On2015-04-06