Incidental Mutation 'R3849:Rimbp3'
ID275840
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene NameRIMS binding protein 3
SynonymsRIM-BP3, LOC239731, LOC385766
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17208603-17213982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17210299 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 529 (H529L)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: H529L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: H529L

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179034
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17209743 missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17211688 missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17211094 missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17211702 missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17211436 missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17211615 missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17209608 nonsense probably null
IGL03285:Rimbp3 APN 16 17213232 missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17210716 missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17209453 missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17211780 missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17211699 missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17212737 missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17211113 missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17212632 missense probably benign
R1946:Rimbp3 UTSW 16 17210427 missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17209675 missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17210299 missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17209692 missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17213098 missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17209189 missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17210601 missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17209807 missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17213331 missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17209917 missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17210844 missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17211888 missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17210917 missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17212270 missense probably damaging 1.00
R6126:Rimbp3 UTSW 16 17212276 missense probably benign 0.25
R6288:Rimbp3 UTSW 16 17212908 missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17212929 missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17209015 missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17209746 missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17211108 missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17210326 missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17211204 missense probably benign
R7440:Rimbp3 UTSW 16 17213201 missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17212704 missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
R7962:Rimbp3 UTSW 16 17211046 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCTACAGATCGAAGCATTGAGGC -3'
(R):5'- ATTCTCCTCTGACAGCCTGG -3'

Sequencing Primer
(F):5'- CATTGAGGCGGGAGTGC -3'
(R):5'- ACAGCCTGGCGCCTTTG -3'
Posted On2015-04-06