Mutagenetix > Incidental Mutations

Incidental Mutation 'R3849:Axin1'

275842

Institutional Source

Beutler Lab

Gene Symbol

Axin1

Ensembl Gene

ENSMUSG00000024182

Gene Name

axin 1

Synonyms

MMRRC Submission

040897-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3849 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26138688-26195811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26187797 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 455 (Y455N)

Ref Sequence

ENSEMBL: ENSMUSP00000132000 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]

Predicted Effect

probably benign
Transcript: ENSMUST00000074370
AA Change: Y455N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: Y455N

Domain	Start	End	E-Value	Type
Pfam:AXIN1_TNKS_BD	13	85	7.5e-27	PFAM
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	523	3.2e-13	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
low complexity region	713	727	N/A	INTRINSIC
DAX	786	868	5.92e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118904
AA Change: Y455N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: Y455N

Domain	Start	End	E-Value	Type
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	502	1.2e-18	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
coiled coil region	712	734	N/A	INTRINSIC
DAX	750	832	5.92e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163421
AA Change: Y455N

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: Y455N

Domain	Start	End	E-Value	Type
RGS	93	216	3.03e-36	SMART
low complexity region	230	241	N/A	INTRINSIC
low complexity region	330	344	N/A	INTRINSIC
coiled coil region	394	432	N/A	INTRINSIC
Pfam:Axin_b-cat_bind	468	502	1.2e-18	PFAM
low complexity region	533	544	N/A	INTRINSIC
low complexity region	699	709	N/A	INTRINSIC
coiled coil region	712	734	N/A	INTRINSIC
DAX	750	832	5.92e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168282

SMART Domains

Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
coiled coil region	126	154	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169268

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	A	T	7: 137,376,340	N102K	possibly damaging	Het
Abca1	C	T	4: 53,061,481		probably benign	Het
Adamts17	T	A	7: 66,840,467	L99Q	possibly damaging	Het
Adamtsl1	A	T	4: 86,418,546	Q1564L	probably damaging	Het
Aspm	T	A	1: 139,458,286	V556E	probably benign	Het
BC017158	C	T	7: 128,285,208	V201I	probably damaging	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Car8	T	A	4: 8,189,353	I154F	probably benign	Het
Ccl27a	T	A	4: 41,773,232	T76S	probably benign	Het
Cep170	G	A	1: 176,755,843	A990V	probably benign	Het
Chd1	A	T	17: 15,731,871	T291S	probably damaging	Het
Col3a1	C	A	1: 45,321,990	P112T	unknown	Het
Cpa4	T	C	6: 30,590,873	F390S	probably damaging	Het
Cul5	T	G	9: 53,617,986	M800L	probably benign	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Dusp8	T	C	7: 142,090,065	E37G	probably damaging	Het
Efr3b	T	C	12: 3,983,414	N131S	probably benign	Het
Fan1	T	C	7: 64,372,371	Y378C	probably damaging	Het
Fcgr2b	T	C	1: 170,968,135	N75S	possibly damaging	Het
Foxp4	A	G	17: 47,875,528	I442T	unknown	Het
Gp9	A	G	6: 87,779,151	I49M	probably benign	Het
Grip1	G	A	10: 119,929,958	G65D	probably damaging	Het
Hoxc10	T	C	15: 102,967,444	V196A	probably benign	Het
Hpx	A	G	7: 105,596,291	C92R	probably damaging	Het
Ighv1-22	A	G	12: 114,746,681	F9S	possibly damaging	Het
Kif24	C	T	4: 41,404,734	R422H	probably damaging	Het
Klk1b1	T	C	7: 43,969,327	Y43H	probably damaging	Het
Lmo7	A	G	14: 101,922,095		probably null	Het
Lrguk	A	G	6: 34,073,768	D387G	probably damaging	Het
Lysmd1	G	A	3: 95,138,461	G203D	probably damaging	Het
Mpnd	T	C	17: 56,011,692	S150P	probably damaging	Het
Mrc2	T	C	11: 105,292,903		probably null	Het
Mtr	A	G	13: 12,247,365	S152P	probably benign	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Ndufa13	T	C	8: 69,901,610	D9G	probably damaging	Het
Nek1	T	A	8: 61,072,315	F596I	probably damaging	Het
Nsd1	A	G	13: 55,246,691	T702A	probably benign	Het
Olfr77	A	T	9: 19,920,809	Y200F	probably damaging	Het
Pam	T	A	1: 97,854,756		probably benign	Het
Plxna1	C	A	6: 89,356,519	R376L	probably damaging	Het
Plxnc1	A	G	10: 94,794,432	V1535A	probably benign	Het
Prdx5	A	G	19: 6,906,850	L166P	probably damaging	Het
Prol1	A	T	5: 88,328,617	I289F	unknown	Het
Prss23	T	C	7: 89,509,751	Y370C	probably damaging	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rnase2b	T	A	14: 51,162,748	H95Q	probably damaging	Het
Rnf103	C	G	6: 71,508,875	C163W	probably damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Syne2	C	T	12: 76,046,065	Q5150*	probably null	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Vwa3a	A	T	7: 120,762,464	K133*	probably null	Het
Vwce	T	C	19: 10,646,905	S387P	probably damaging	Het
Zbtb41	T	A	1: 139,423,996	H282Q	probably benign	Het

Other mutations in Axin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Axin1	APN	17	26142805	missense	possibly damaging	0.88
IGL00229:Axin1	APN	17	26194072	missense	probably damaging	1.00
IGL01141:Axin1	APN	17	26190041	missense	probably damaging	0.98
IGL02088:Axin1	APN	17	26188695	missense	probably benign	0.05
IGL02413:Axin1	APN	17	26188179	missense	probably benign	0.00
Salvation	UTSW	17	26143240	missense	probably damaging	0.98
R0331:Axin1	UTSW	17	26143107	missense	probably damaging	1.00
R0454:Axin1	UTSW	17	26173663	missense	probably benign	0.00
R0538:Axin1	UTSW	17	26184241	missense	possibly damaging	0.66
R0755:Axin1	UTSW	17	26182506	missense	possibly damaging	0.95
R0976:Axin1	UTSW	17	26188086	missense	probably damaging	1.00
R1634:Axin1	UTSW	17	26187991	missense	probably damaging	0.99
R1950:Axin1	UTSW	17	26193964	missense	possibly damaging	0.62
R1965:Axin1	UTSW	17	26184225	missense	probably damaging	1.00
R1965:Axin1	UTSW	17	26190228	missense	probably damaging	0.97
R2180:Axin1	UTSW	17	26143335	missense	probably benign
R3051:Axin1	UTSW	17	26190125	missense	probably benign	0.01
R3413:Axin1	UTSW	17	26188038	missense	probably damaging	0.99
R4530:Axin1	UTSW	17	26188172	missense	probably benign	0.09
R4560:Axin1	UTSW	17	26173771	missense	probably damaging	1.00
R4764:Axin1	UTSW	17	26173756	missense	possibly damaging	0.46
R4976:Axin1	UTSW	17	26194070	missense	probably benign	0.42
R4976:Axin1	UTSW	17	26194071	missense	probably benign	0.24
R5299:Axin1	UTSW	17	26173734	missense	probably damaging	0.99
R5682:Axin1	UTSW	17	26187801	missense	probably benign
R5690:Axin1	UTSW	17	26194937	missense	probably damaging	1.00
R5722:Axin1	UTSW	17	26182557	missense	probably damaging	1.00
R5793:Axin1	UTSW	17	26143308	missense	probably damaging	1.00
R6108:Axin1	UTSW	17	26143240	missense	probably damaging	0.98
R6282:Axin1	UTSW	17	26143037	missense	probably damaging	1.00
R6490:Axin1	UTSW	17	26142994	missense	probably damaging	1.00
R7153:Axin1	UTSW	17	26187968	missense	probably benign
R7181:Axin1	UTSW	17	26173778	missense	probably damaging	1.00
R7456:Axin1	UTSW	17	26143165	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTGACCTCTTTGACTTGAC -3'
(R):5'- CCAGCTTCAACCCTAACTTAGG -3'

Sequencing Primer
(F):5'- GACTCTCAGACTGTGGTTCAC -3'
(R):5'- ATGCTTCCCATGCCCGGAG -3'

Posted On

2015-04-06