Incidental Mutation 'R3849:Prdx5'
ID275846
Institutional Source Beutler Lab
Gene Symbol Prdx5
Ensembl Gene ENSMUSG00000024953
Gene Nameperoxiredoxin 5
SynonymsAOPP, PMP20, Prdx6, PrxV, AOEB166, peroxiredoxin V, PrxV
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6906697-6910106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6906850 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 166 (L166P)
Ref Sequence ENSEMBL: ENSMUSP00000134521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025904] [ENSMUST00000025906] [ENSMUST00000088257] [ENSMUST00000116551] [ENSMUST00000149261] [ENSMUST00000173091] [ENSMUST00000174786]
Predicted Effect probably damaging
Transcript: ENSMUST00000025904
AA Change: L210P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025904
Gene: ENSMUSG00000024953
AA Change: L210P

DomainStartEndE-ValueType
Pfam:Redoxin 53 206 1e-31 PFAM
Pfam:AhpC-TSA 54 189 8.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025906
SMART Domains Protein: ENSMUSP00000025906
Gene: ENSMUSG00000024955

DomainStartEndE-ValueType
internal_repeat_1 5 21 6.74e-5 PROSPERO
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 76 147 2.16e-40 SMART
low complexity region 169 187 N/A INTRINSIC
internal_repeat_1 202 218 6.74e-5 PROSPERO
HOLI 229 391 9.21e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088257
SMART Domains Protein: ENSMUSP00000085591
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116551
SMART Domains Protein: ENSMUSP00000112250
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 112 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145300
Predicted Effect probably damaging
Transcript: ENSMUST00000149261
AA Change: L213P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135084
Gene: ENSMUSG00000024953
AA Change: L213P

DomainStartEndE-ValueType
Pfam:Redoxin 56 210 1.1e-31 PFAM
Pfam:AhpC-TSA 57 192 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172869
Predicted Effect probably damaging
Transcript: ENSMUST00000173091
AA Change: L166P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134521
Gene: ENSMUSG00000024953
AA Change: L166P

DomainStartEndE-ValueType
Pfam:Redoxin 53 99 3.3e-11 PFAM
Pfam:AhpC-TSA 54 100 9.3e-8 PFAM
Pfam:Redoxin 97 163 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174786
SMART Domains Protein: ENSMUSP00000134000
Gene: ENSMUSG00000038812

DomainStartEndE-ValueType
Pfam:Trm112p 2 101 5.6e-11 PFAM
Meta Mutation Damage Score 0.8463 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Vwce T C 19: 10,646,905 S387P probably damaging Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Prdx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Prdx5 APN 19 6909595 missense probably benign 0.06
R1601:Prdx5 UTSW 19 6907558 missense possibly damaging 0.56
R1886:Prdx5 UTSW 19 6908190 missense probably benign 0.26
R3713:Prdx5 UTSW 19 6908109 missense probably damaging 1.00
R4420:Prdx5 UTSW 19 6907964 unclassified probably null
R4622:Prdx5 UTSW 19 6906973 unclassified probably benign
R7211:Prdx5 UTSW 19 6907590 missense probably damaging 1.00
R7423:Prdx5 UTSW 19 6910002 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TATGGCTGCACGTGAGCAAG -3'
(R):5'- TCTCTTTGGGAATCGTCGGC -3'

Sequencing Primer
(F):5'- GGGCAAAGCAGACAACCCTG -3'
(R):5'- CTTTGGGAATCGTCGGCTGAAAAG -3'
Posted On2015-04-06