Incidental Mutation 'R3849:Vwce'
ID275847
Institutional Source Beutler Lab
Gene Symbol Vwce
Ensembl Gene ENSMUSG00000043789
Gene Namevon Willebrand factor C and EGF domains
Synonyms1300015B04Rik
MMRRC Submission 040897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3849 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10634233-10665210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10646905 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 387 (S387P)
Ref Sequence ENSEMBL: ENSMUSP00000056958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055115]
Predicted Effect probably damaging
Transcript: ENSMUST00000055115
AA Change: S387P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789
AA Change: S387P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Meta Mutation Damage Score 0.0926 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik A T 7: 137,376,340 N102K possibly damaging Het
Abca1 C T 4: 53,061,481 probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Aspm T A 1: 139,458,286 V556E probably benign Het
Axin1 T A 17: 26,187,797 Y455N probably benign Het
BC017158 C T 7: 128,285,208 V201I probably damaging Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Car8 T A 4: 8,189,353 I154F probably benign Het
Ccl27a T A 4: 41,773,232 T76S probably benign Het
Cep170 G A 1: 176,755,843 A990V probably benign Het
Chd1 A T 17: 15,731,871 T291S probably damaging Het
Col3a1 C A 1: 45,321,990 P112T unknown Het
Cpa4 T C 6: 30,590,873 F390S probably damaging Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Dusp8 T C 7: 142,090,065 E37G probably damaging Het
Efr3b T C 12: 3,983,414 N131S probably benign Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fcgr2b T C 1: 170,968,135 N75S possibly damaging Het
Foxp4 A G 17: 47,875,528 I442T unknown Het
Gp9 A G 6: 87,779,151 I49M probably benign Het
Grip1 G A 10: 119,929,958 G65D probably damaging Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hpx A G 7: 105,596,291 C92R probably damaging Het
Ighv1-22 A G 12: 114,746,681 F9S possibly damaging Het
Kif24 C T 4: 41,404,734 R422H probably damaging Het
Klk1b1 T C 7: 43,969,327 Y43H probably damaging Het
Lmo7 A G 14: 101,922,095 probably null Het
Lrguk A G 6: 34,073,768 D387G probably damaging Het
Lysmd1 G A 3: 95,138,461 G203D probably damaging Het
Mpnd T C 17: 56,011,692 S150P probably damaging Het
Mrc2 T C 11: 105,292,903 probably null Het
Mtr A G 13: 12,247,365 S152P probably benign Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Ndufa13 T C 8: 69,901,610 D9G probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nsd1 A G 13: 55,246,691 T702A probably benign Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pam T A 1: 97,854,756 probably benign Het
Plxna1 C A 6: 89,356,519 R376L probably damaging Het
Plxnc1 A G 10: 94,794,432 V1535A probably benign Het
Prdx5 A G 19: 6,906,850 L166P probably damaging Het
Prol1 A T 5: 88,328,617 I289F unknown Het
Prss23 T C 7: 89,509,751 Y370C probably damaging Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rnase2b T A 14: 51,162,748 H95Q probably damaging Het
Rnf103 C G 6: 71,508,875 C163W probably damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Syne2 C T 12: 76,046,065 Q5150* probably null Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Tead2 T A 7: 45,232,328 probably null Het
Vwa3a A T 7: 120,762,464 K133* probably null Het
Zbtb41 T A 1: 139,423,996 H282Q probably benign Het
Other mutations in Vwce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Vwce APN 19 10664511 unclassified probably null
IGL01358:Vwce APN 19 10664409 missense possibly damaging 0.86
IGL02330:Vwce APN 19 10646801 missense possibly damaging 0.96
IGL02477:Vwce APN 19 10664618 unclassified probably null
IGL02551:Vwce APN 19 10645036 missense possibly damaging 0.71
IGL02606:Vwce APN 19 10655348 splice site probably benign
IGL02633:Vwce APN 19 10648494 missense probably damaging 0.98
IGL02656:Vwce APN 19 10664352 missense probably benign
IGL02884:Vwce APN 19 10646579 missense possibly damaging 0.53
IGL02973:Vwce APN 19 10655400 nonsense probably null
IGL03038:Vwce APN 19 10646671 missense possibly damaging 0.86
IGL03329:Vwce APN 19 10659996 missense possibly damaging 0.73
PIT4403001:Vwce UTSW 19 10638097 missense possibly damaging 0.53
PIT4431001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
PIT4519001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
R0042:Vwce UTSW 19 10646813 missense probably benign
R0081:Vwce UTSW 19 10664089 critical splice acceptor site probably null
R0142:Vwce UTSW 19 10664612 missense probably damaging 0.97
R0165:Vwce UTSW 19 10659973 splice site probably benign
R0948:Vwce UTSW 19 10653077 missense probably damaging 1.00
R1053:Vwce UTSW 19 10664099 missense probably benign 0.18
R1505:Vwce UTSW 19 10664244 missense probably benign
R1623:Vwce UTSW 19 10646744 nonsense probably null
R1672:Vwce UTSW 19 10653095 missense possibly damaging 0.92
R1882:Vwce UTSW 19 10638156 missense possibly damaging 0.53
R4292:Vwce UTSW 19 10659632 missense probably benign 0.00
R4293:Vwce UTSW 19 10659632 missense probably benign 0.00
R4531:Vwce UTSW 19 10664346 missense probably benign 0.01
R4678:Vwce UTSW 19 10664648 missense possibly damaging 0.86
R4720:Vwce UTSW 19 10648467 missense possibly damaging 0.85
R4737:Vwce UTSW 19 10650579 missense probably benign 0.33
R4864:Vwce UTSW 19 10650636 missense probably benign 0.01
R4916:Vwce UTSW 19 10646879 missense probably damaging 0.98
R4939:Vwce UTSW 19 10645050 missense probably damaging 0.98
R5605:Vwce UTSW 19 10658038 missense possibly damaging 0.95
R5735:Vwce UTSW 19 10647067 missense probably benign 0.08
R5780:Vwce UTSW 19 10650619 missense probably damaging 1.00
R6158:Vwce UTSW 19 10644221 missense possibly damaging 0.91
R6383:Vwce UTSW 19 10659592 nonsense probably null
R6920:Vwce UTSW 19 10664693 missense probably benign
R7201:Vwce UTSW 19 10638115 missense possibly damaging 0.72
R7276:Vwce UTSW 19 10664174 missense possibly damaging 0.53
R7423:Vwce UTSW 19 10664340 missense probably benign 0.02
R7474:Vwce UTSW 19 10646941 missense possibly damaging 0.93
RF020:Vwce UTSW 19 10653085 missense probably damaging 1.00
X0018:Vwce UTSW 19 10656662 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACACAGTTGATATCCACTCCAG -3'
(R):5'- AGAGCTCTTACCAGTGCAAGAG -3'

Sequencing Primer
(F):5'- GTTGATATCCACTCCAGTGCCAAG -3'
(R):5'- ATCTCTCGGGGGAACTGG -3'
Posted On2015-04-06