Mutagenetix > Incidental Mutations

Incidental Mutation 'R3850:Rb1cc1'

275848

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

040898-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6250113 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1252 (V1252D)

Ref Sequence

ENSEMBL: ENSMUSP00000027040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]

AlphaFold

Q9ESK9

Predicted Effect

probably benign
Transcript: ENSMUST00000027040
AA Change: V1252D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: V1252D

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159206

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159661

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159802

Predicted Effect

unknown
Transcript: ENSMUST00000161327
AA Change: V1131D

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: V1131D

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000162257
AA Change: V342D

SMART Domains

Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907
AA Change: V342D

Domain	Start	End	E-Value	Type
coiled coil region	33	331	N/A	INTRINSIC
low complexity region	335	355	N/A	INTRINSIC
coiled coil region	363	483	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162795

SMART Domains

Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	2e-4	SMART
Blast:UBQ	3	76	4e-12	BLAST
low complexity region	454	469	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
coiled coil region	842	865	N/A	INTRINSIC

Meta Mutation Damage Score

0.0611

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066B19Rik	G	A	18: 35,728,714	V84I	probably benign	Het
Abca1	C	T	4: 53,061,481		probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Adamts17	T	A	7: 66,840,467	L99Q	possibly damaging	Het
Adamtsl1	A	T	4: 86,418,546	Q1564L	probably damaging	Het
Als2cl	A	G	9: 110,889,309		probably benign	Het
Antxrl	C	A	14: 34,067,381	H309Q	probably benign	Het
Ap1g2	T	C	14: 55,104,906	M165V	probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cdh16	T	C	8: 104,617,841	D22G	possibly damaging	Het
Cdh17	A	G	4: 11,785,201	D331G	probably damaging	Het
Csmd1	C	G	8: 16,079,922	V1729L	probably benign	Het
Cul5	T	G	9: 53,617,986	M800L	probably benign	Het
Cwf19l1	T	C	19: 44,131,498	Y68C	probably benign	Het
Dst	C	T	1: 34,189,274	Q1658*	probably null	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fan1	T	C	7: 64,372,371	Y378C	probably damaging	Het
Fat4	T	A	3: 39,007,261	V4331D	probably benign	Het
Fbxl8	T	C	8: 105,267,149	S46P	probably benign	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Hoxc10	T	C	15: 102,967,444	V196A	probably benign	Het
Hsf4	T	C	8: 105,270,837	F101L	probably damaging	Het
Hydin	T	C	8: 110,563,929	I3340T	probably damaging	Het
Igfbpl1	C	T	4: 45,826,426	R123H	probably benign	Het
Mov10l1	A	T	15: 89,005,695		probably null	Het
Mrc2	T	C	11: 105,292,903		probably null	Het
Muc5b	G	A	7: 141,862,638	C3107Y	possibly damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Nek1	T	A	8: 61,072,315	F596I	probably damaging	Het
Nfasc	T	C	1: 132,631,733	T214A	probably damaging	Het
Olfr1107	T	A	2: 87,071,966	H56L	possibly damaging	Het
Olfr1245	T	C	2: 89,575,034	R231G	probably damaging	Het
Olfr77	A	T	9: 19,920,809	Y200F	probably damaging	Het
Pcdhga10	C	T	18: 37,749,021	P612S	probably damaging	Het
Picalm	A	G	7: 90,191,704	N456S	probably damaging	Het
Pigo	A	G	4: 43,025,084	F5S	probably benign	Het
Pikfyve	T	C	1: 65,230,845	F563S	probably damaging	Het
Plod2	A	G	9: 92,542,545	E29G	probably benign	Het
Pm20d2	A	G	4: 33,174,414	V403A	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rmdn3	A	T	2: 119,156,422	H41Q	possibly damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Ror1	A	G	4: 100,442,160	Y910C	possibly damaging	Het
Scn2a	C	T	2: 65,682,031	L171F	probably benign	Het
Sh3pxd2b	A	G	11: 32,411,505	E239G	probably damaging	Het
Snx27	G	T	3: 94,520,235	T311K	probably benign	Het
Sspo	T	A	6: 48,492,490	L4459Q	probably damaging	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thap12	G	T	7: 98,716,663	K679N	probably damaging	Het
Vmn2r65	T	A	7: 84,946,651	H275L	probably benign	Het
Wfs1	C	A	5: 36,968,624	V308L	probably benign	Het
Zfp229	C	A	17: 21,745,862	H358N	probably damaging	Het
Zfp687	T	C	3: 95,007,914	D1092G	probably damaging	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R0837:Rb1cc1	UTSW	1	6234271	splice site	probably null
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1542:Rb1cc1	UTSW	1	6244249	missense	possibly damaging	0.82
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5196:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6313:Rb1cc1	UTSW	1	6244133	missense	probably benign	0.00
R6345:Rb1cc1	UTSW	1	6263257	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7618:Rb1cc1	UTSW	1	6265558	splice site	probably null
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R7774:Rb1cc1	UTSW	1	6248085	missense	possibly damaging	0.63
R7780:Rb1cc1	UTSW	1	6248914	nonsense	probably null
R7947:Rb1cc1	UTSW	1	6248562	missense	probably damaging	1.00
R8057:Rb1cc1	UTSW	1	6245219	missense	probably damaging	1.00
R8094:Rb1cc1	UTSW	1	6263224	nonsense	probably null
R8527:Rb1cc1	UTSW	1	6244875	missense	probably damaging	1.00
R8758:Rb1cc1	UTSW	1	6240227	missense	probably benign	0.10
R8843:Rb1cc1	UTSW	1	6245171	missense	probably damaging	1.00
R8922:Rb1cc1	UTSW	1	6248970	missense	probably benign
R8937:Rb1cc1	UTSW	1	6263217	missense	probably benign
R9018:Rb1cc1	UTSW	1	6249266	missense	probably benign
R9106:Rb1cc1	UTSW	1	6248885	missense
R9127:Rb1cc1	UTSW	1	6262849	missense	probably damaging	1.00
R9130:Rb1cc1	UTSW	1	6244885	missense	probably damaging	0.99
R9311:Rb1cc1	UTSW	1	6240315	missense	probably damaging	1.00
R9365:Rb1cc1	UTSW	1	6244893	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TTTGCATCGCCAAGCATATG -3'
(R):5'- GACCATTCTGTATATTCCCATCGAC -3'

Sequencing Primer
(F):5'- TGCATCGCCAAGCATATGAAATAG -3'
(R):5'- AACTAGTTCACTCTGTAGCCCAGG -3'

Posted On

2015-04-06