Incidental Mutation 'R3850:Or4a72'
ID 275855
Institutional Source Beutler Lab
Gene Symbol Or4a72
Ensembl Gene ENSMUSG00000111456
Gene Name olfactory receptor family 4 subfamily A member 72
Synonyms GA_x6K02T2Q125-51020951-51020028, MOR231-12, Olfr1245
MMRRC Submission 040898-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R3850 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 89405056-89406117 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89405378 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 231 (R231G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000214870] [ENSMUST00000217402]
AlphaFold A0A1L1SQJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000099766
AA Change: R231G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097354
Gene: ENSMUSG00000100601
AA Change: R231G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6e-49 PFAM
Pfam:7tm_1 39 285 2.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099773
AA Change: R231G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097361
Gene: ENSMUSG00000075083
AA Change: R231G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.2e-48 PFAM
Pfam:7tm_1 39 285 3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214870
AA Change: R231G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217402
AA Change: R231G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,061,481 (GRCm39) probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Adamts17 T A 7: 66,490,215 (GRCm39) L99Q possibly damaging Het
Adamtsl1 A T 4: 86,336,783 (GRCm39) Q1564L probably damaging Het
Als2cl A G 9: 110,718,377 (GRCm39) probably benign Het
Antxrl C A 14: 33,789,338 (GRCm39) H309Q probably benign Het
Ap1g2 T C 14: 55,342,363 (GRCm39) M165V probably benign Het
Cacna2d3 A G 14: 29,069,077 (GRCm39) probably null Het
Cdh16 T C 8: 105,344,473 (GRCm39) D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 (GRCm39) D331G probably damaging Het
Csmd1 C G 8: 16,129,936 (GRCm39) V1729L probably benign Het
Cul5 T G 9: 53,529,286 (GRCm39) M800L probably benign Het
Cwf19l1 T C 19: 44,119,937 (GRCm39) Y68C probably benign Het
Dst C T 1: 34,228,355 (GRCm39) Q1658* probably null Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fan1 T C 7: 64,022,119 (GRCm39) Y378C probably damaging Het
Fat4 T A 3: 39,061,410 (GRCm39) V4331D probably benign Het
Fbxl8 T C 8: 105,993,781 (GRCm39) S46P probably benign Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Hoxc10 T C 15: 102,875,879 (GRCm39) V196A probably benign Het
Hsf4 T C 8: 105,997,469 (GRCm39) F101L probably damaging Het
Hydin T C 8: 111,290,561 (GRCm39) I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 (GRCm39) R123H probably benign Het
Mov10l1 A T 15: 88,889,898 (GRCm39) probably null Het
Mrc2 T C 11: 105,183,729 (GRCm39) probably null Het
Muc5b G A 7: 141,416,375 (GRCm39) C3107Y possibly damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Nek1 T A 8: 61,525,349 (GRCm39) F596I probably damaging Het
Nfasc T C 1: 132,559,471 (GRCm39) T214A probably damaging Het
Or5aq1b T A 2: 86,902,310 (GRCm39) H56L possibly damaging Het
Or7d10 A T 9: 19,832,105 (GRCm39) Y200F probably damaging Het
Pcdhga10 C T 18: 37,882,074 (GRCm39) P612S probably damaging Het
Picalm A G 7: 89,840,912 (GRCm39) N456S probably damaging Het
Pigo A G 4: 43,025,084 (GRCm39) F5S probably benign Het
Pikfyve T C 1: 65,270,004 (GRCm39) F563S probably damaging Het
Plod2 A G 9: 92,424,598 (GRCm39) E29G probably benign Het
Pm20d2 A G 4: 33,174,414 (GRCm39) V403A probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rb1cc1 T A 1: 6,320,337 (GRCm39) V1252D probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rmdn3 A T 2: 118,986,903 (GRCm39) H41Q possibly damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Ror1 A G 4: 100,299,357 (GRCm39) Y910C possibly damaging Het
Scn2a C T 2: 65,512,375 (GRCm39) L171F probably benign Het
Sh3pxd2b A G 11: 32,361,505 (GRCm39) E239G probably damaging Het
Smim33 G A 18: 35,861,767 (GRCm39) V84I probably benign Het
Snx27 G T 3: 94,427,542 (GRCm39) T311K probably benign Het
Sspo T A 6: 48,469,424 (GRCm39) L4459Q probably damaging Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thap12 G T 7: 98,365,870 (GRCm39) K679N probably damaging Het
Vmn2r65 T A 7: 84,595,859 (GRCm39) H275L probably benign Het
Wfs1 C A 5: 37,125,968 (GRCm39) V308L probably benign Het
Zfp229 C A 17: 21,964,843 (GRCm39) H358N probably damaging Het
Zfp687 T C 3: 94,915,225 (GRCm39) D1092G probably damaging Het
Other mutations in Or4a72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Or4a72 APN 2 89,405,767 (GRCm39) missense possibly damaging 0.68
IGL01690:Or4a72 APN 2 89,405,557 (GRCm39) missense probably benign 0.09
IGL02334:Or4a72 APN 2 89,405,668 (GRCm39) missense possibly damaging 0.95
IGL02435:Or4a72 APN 2 89,405,890 (GRCm39) missense probably damaging 0.99
IGL02793:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL02875:Or4a72 APN 2 89,405,896 (GRCm39) missense probably damaging 1.00
IGL03218:Or4a72 APN 2 89,405,935 (GRCm39) missense probably benign 0.09
IGL03392:Or4a72 APN 2 89,405,593 (GRCm39) missense probably damaging 0.96
H8786:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
I0000:Or4a72 UTSW 2 89,405,497 (GRCm39) missense probably damaging 1.00
R0044:Or4a72 UTSW 2 89,405,974 (GRCm39) missense possibly damaging 0.68
R0190:Or4a72 UTSW 2 89,405,302 (GRCm39) missense probably damaging 0.98
R1585:Or4a72 UTSW 2 89,405,746 (GRCm39) missense possibly damaging 0.89
R1902:Or4a72 UTSW 2 89,405,947 (GRCm39) missense possibly damaging 0.77
R2018:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2019:Or4a72 UTSW 2 89,405,737 (GRCm39) missense probably damaging 0.97
R2020:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2021:Or4a72 UTSW 2 89,405,305 (GRCm39) missense possibly damaging 0.88
R2030:Or4a72 UTSW 2 89,405,558 (GRCm39) missense probably benign 0.00
R2133:Or4a72 UTSW 2 89,405,600 (GRCm39) nonsense probably null
R4066:Or4a72 UTSW 2 89,405,523 (GRCm39) missense probably damaging 1.00
R4754:Or4a72 UTSW 2 89,405,391 (GRCm39) missense probably benign
R4923:Or4a72 UTSW 2 89,406,023 (GRCm39) missense probably damaging 0.98
R5303:Or4a72 UTSW 2 89,405,345 (GRCm39) missense possibly damaging 0.88
R5574:Or4a72 UTSW 2 89,405,321 (GRCm39) missense possibly damaging 0.94
R6083:Or4a72 UTSW 2 89,406,016 (GRCm39) missense probably benign 0.42
R6188:Or4a72 UTSW 2 89,405,538 (GRCm39) nonsense probably null
R6724:Or4a72 UTSW 2 89,405,309 (GRCm39) missense probably benign 0.26
R6964:Or4a72 UTSW 2 89,405,333 (GRCm39) missense probably benign
R7066:Or4a72 UTSW 2 89,406,047 (GRCm39) missense probably damaging 0.98
R7401:Or4a72 UTSW 2 89,405,449 (GRCm39) missense probably benign 0.27
R8232:Or4a72 UTSW 2 89,405,938 (GRCm39) missense noncoding transcript
R8558:Or4a72 UTSW 2 89,405,329 (GRCm39) missense probably damaging 1.00
R8708:Or4a72 UTSW 2 89,405,623 (GRCm39) missense probably damaging 1.00
R9482:Or4a72 UTSW 2 89,405,953 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGATAGAATTTTGCACCAGAG -3'
(R):5'- TGGTGGTTTTACACACTCTCTG -3'

Sequencing Primer
(F):5'- GCACCAGAGCTTTTTCATACAAG -3'
(R):5'- ACACACTCTCTGATTCAAATTGTC -3'
Posted On 2015-04-06