Incidental Mutation 'R3850:Tead2'
ID275869
Institutional Source Beutler Lab
Gene Symbol Tead2
Ensembl Gene ENSMUSG00000030796
Gene NameTEA domain family member 2
SynonymsTEAD-2, TEF-4, Etdf
MMRRC Submission 040898-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3850 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45215753-45233644 bp(+) (GRCm38)
Type of Mutationunclassified (1842 bp from exon)
DNA Base Change (assembly) T to A at 45232328 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033060] [ENSMUST00000033063] [ENSMUST00000097216] [ENSMUST00000098461] [ENSMUST00000107801] [ENSMUST00000209343] [ENSMUST00000209478] [ENSMUST00000209779] [ENSMUST00000210078] [ENSMUST00000210226] [ENSMUST00000211373]
Predicted Effect probably damaging
Transcript: ENSMUST00000033060
AA Change: I406N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033060
Gene: ENSMUSG00000030796
AA Change: I406N

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect probably null
Transcript: ENSMUST00000033063
SMART Domains Protein: ENSMUSP00000033063
Gene: ENSMUSG00000030798

DomainStartEndE-ValueType
Pfam:Tetraspannin 31 292 9.5e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097216
AA Change: I371N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103430
Gene: ENSMUSG00000030796
AA Change: I371N

DomainStartEndE-ValueType
low complexity region 11 38 N/A INTRINSIC
Pfam:TEA 40 402 1.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098461
SMART Domains Protein: ENSMUSP00000096061
Gene: ENSMUSG00000030798

DomainStartEndE-ValueType
Pfam:Tetraspannin 10 270 3.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107801
AA Change: I406N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103431
Gene: ENSMUSG00000030796
AA Change: I406N

DomainStartEndE-ValueType
TEA 36 107 4.84e-52 SMART
low complexity region 201 217 N/A INTRINSIC
PDB:3L15|B 218 445 1e-143 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143734
AA Change: S61T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209222
Predicted Effect probably benign
Transcript: ENSMUST00000209343
Predicted Effect probably damaging
Transcript: ENSMUST00000209478
AA Change: I90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209677
Predicted Effect probably null
Transcript: ENSMUST00000209779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210000
Predicted Effect probably null
Transcript: ENSMUST00000210078
Predicted Effect probably benign
Transcript: ENSMUST00000210226
Predicted Effect probably null
Transcript: ENSMUST00000211373
Meta Mutation Damage Score 0.9519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a functionally null allele of this gene exhibit no gross abnormalities and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066B19Rik G A 18: 35,728,714 V84I probably benign Het
Abca1 C T 4: 53,061,481 probably benign Het
Abcc5 A T 16: 20,372,156 S815T probably benign Het
Adamts17 T A 7: 66,840,467 L99Q possibly damaging Het
Adamtsl1 A T 4: 86,418,546 Q1564L probably damaging Het
Als2cl A G 9: 110,889,309 probably benign Het
Antxrl C A 14: 34,067,381 H309Q probably benign Het
Ap1g2 T C 14: 55,104,906 M165V probably benign Het
Cacna2d3 A G 14: 29,347,120 probably null Het
Cdh16 T C 8: 104,617,841 D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 D331G probably damaging Het
Csmd1 C G 8: 16,079,922 V1729L probably benign Het
Cul5 T G 9: 53,617,986 M800L probably benign Het
Cwf19l1 T C 19: 44,131,498 Y68C probably benign Het
Dst C T 1: 34,189,274 Q1658* probably null Het
Dst C T 1: 34,212,319 S4165F probably damaging Het
Fan1 T C 7: 64,372,371 Y378C probably damaging Het
Fat4 T A 3: 39,007,261 V4331D probably benign Het
Fbxl8 T C 8: 105,267,149 S46P probably benign Het
Golgb1 C A 16: 36,898,733 Q334K probably benign Het
Hoxc10 T C 15: 102,967,444 V196A probably benign Het
Hsf4 T C 8: 105,270,837 F101L probably damaging Het
Hydin T C 8: 110,563,929 I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 R123H probably benign Het
Mov10l1 A T 15: 89,005,695 probably null Het
Mrc2 T C 11: 105,292,903 probably null Het
Muc5b G A 7: 141,862,638 C3107Y possibly damaging Het
Naip2 A T 13: 100,179,432 L280Q probably damaging Het
Naip2 G C 13: 100,179,433 L280V probably damaging Het
Nek1 T A 8: 61,072,315 F596I probably damaging Het
Nfasc T C 1: 132,631,733 T214A probably damaging Het
Olfr1107 T A 2: 87,071,966 H56L possibly damaging Het
Olfr1245 T C 2: 89,575,034 R231G probably damaging Het
Olfr77 A T 9: 19,920,809 Y200F probably damaging Het
Pcdhga10 C T 18: 37,749,021 P612S probably damaging Het
Picalm A G 7: 90,191,704 N456S probably damaging Het
Pigo A G 4: 43,025,084 F5S probably benign Het
Pikfyve T C 1: 65,230,845 F563S probably damaging Het
Plod2 A G 9: 92,542,545 E29G probably benign Het
Pm20d2 A G 4: 33,174,414 V403A probably damaging Het
Proz A G 8: 13,073,533 E268G probably benign Het
Rb1cc1 T A 1: 6,250,113 V1252D probably benign Het
Rimbp3 A T 16: 17,210,299 H529L probably benign Het
Rmdn3 A T 2: 119,156,422 H41Q possibly damaging Het
Rnf17 T C 14: 56,512,296 V1433A probably damaging Het
Ror1 A G 4: 100,442,160 Y910C possibly damaging Het
Scn2a C T 2: 65,682,031 L171F probably benign Het
Sh3pxd2b A G 11: 32,411,505 E239G probably damaging Het
Snx27 G T 3: 94,520,235 T311K probably benign Het
Sspo T A 6: 48,492,490 L4459Q probably damaging Het
Syne2 T C 12: 76,048,622 L5241P probably damaging Het
Tas2r110 T A 6: 132,868,675 I223N probably damaging Het
Thap12 G T 7: 98,716,663 K679N probably damaging Het
Vmn2r65 T A 7: 84,946,651 H275L probably benign Het
Wfs1 C A 5: 36,968,624 V308L probably benign Het
Zfp229 C A 17: 21,745,862 H358N probably damaging Het
Zfp687 T C 3: 95,007,914 D1092G probably damaging Het
Other mutations in Tead2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Tead2 APN 7 45217251 missense probably damaging 0.96
IGL01887:Tead2 APN 7 45232310 missense probably damaging 1.00
IGL02378:Tead2 APN 7 45218147 critical splice donor site probably null
IGL02441:Tead2 APN 7 45217421 missense probably damaging 1.00
IGL02716:Tead2 APN 7 45232296 nonsense probably null
IGL02939:Tead2 APN 7 45220434 splice site probably benign
IGL03302:Tead2 APN 7 45232899 missense possibly damaging 0.86
R0325:Tead2 UTSW 7 45225755 missense probably damaging 1.00
R0611:Tead2 UTSW 7 45217250 missense probably damaging 0.99
R2571:Tead2 UTSW 7 45225770 missense probably damaging 1.00
R3401:Tead2 UTSW 7 45223673 unclassified probably benign
R3847:Tead2 UTSW 7 45232328 unclassified probably null
R3849:Tead2 UTSW 7 45232328 unclassified probably null
R5729:Tead2 UTSW 7 45220742 unclassified probably benign
R5932:Tead2 UTSW 7 45232899 missense probably benign 0.00
R5956:Tead2 UTSW 7 45220714 unclassified probably benign
R6208:Tead2 UTSW 7 45218102 missense probably damaging 1.00
R6729:Tead2 UTSW 7 45217234 missense probably benign
R7152:Tead2 UTSW 7 45220447 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTAAGGGTGAAGCTTCGGTC -3'
(R):5'- TTCTCAGAGAAGCCAGATGC -3'

Sequencing Primer
(F):5'- GTGGCCGTGATCTCTCTCAG -3'
(R):5'- GCTTAGAAGCCGAGGTATCTC -3'
Posted On2015-04-06