Mutagenetix > Incidental Mutations

Incidental Mutation 'R3850:Plod2'

275885

Institutional Source

Beutler Lab

Gene Symbol

Plod2

Ensembl Gene

ENSMUSG00000032374

Gene Name

procollagen lysine, 2-oxoglutarate 5-dioxygenase 2

Synonyms

D530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2

MMRRC Submission

040898-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3850 (G1)

Quality Score

148

Status

Validated

Chromosome

Chromosomal Location

92542223-92608428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92542545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 29 (E29G)

Ref Sequence

ENSEMBL: ENSMUSP00000068611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]

AlphaFold

Q9R0B9

Predicted Effect

probably benign
Transcript: ENSMUST00000070522
AA Change: E29G

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: E29G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	563	736	6.38e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160359
AA Change: E29G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: E29G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	181	193	N/A	INTRINSIC
low complexity region	307	321	N/A	INTRINSIC
Blast:P4Hc	453	500	1e-22	BLAST
P4Hc	584	757	6.38e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191720

Meta Mutation Damage Score

0.0826

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066B19Rik	G	A	18: 35,728,714	V84I	probably benign	Het
Abca1	C	T	4: 53,061,481		probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Adamts17	T	A	7: 66,840,467	L99Q	possibly damaging	Het
Adamtsl1	A	T	4: 86,418,546	Q1564L	probably damaging	Het
Als2cl	A	G	9: 110,889,309		probably benign	Het
Antxrl	C	A	14: 34,067,381	H309Q	probably benign	Het
Ap1g2	T	C	14: 55,104,906	M165V	probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cdh16	T	C	8: 104,617,841	D22G	possibly damaging	Het
Cdh17	A	G	4: 11,785,201	D331G	probably damaging	Het
Csmd1	C	G	8: 16,079,922	V1729L	probably benign	Het
Cul5	T	G	9: 53,617,986	M800L	probably benign	Het
Cwf19l1	T	C	19: 44,131,498	Y68C	probably benign	Het
Dst	C	T	1: 34,189,274	Q1658*	probably null	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fan1	T	C	7: 64,372,371	Y378C	probably damaging	Het
Fat4	T	A	3: 39,007,261	V4331D	probably benign	Het
Fbxl8	T	C	8: 105,267,149	S46P	probably benign	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Hoxc10	T	C	15: 102,967,444	V196A	probably benign	Het
Hsf4	T	C	8: 105,270,837	F101L	probably damaging	Het
Hydin	T	C	8: 110,563,929	I3340T	probably damaging	Het
Igfbpl1	C	T	4: 45,826,426	R123H	probably benign	Het
Mov10l1	A	T	15: 89,005,695		probably null	Het
Mrc2	T	C	11: 105,292,903		probably null	Het
Muc5b	G	A	7: 141,862,638	C3107Y	possibly damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Nek1	T	A	8: 61,072,315	F596I	probably damaging	Het
Nfasc	T	C	1: 132,631,733	T214A	probably damaging	Het
Olfr1107	T	A	2: 87,071,966	H56L	possibly damaging	Het
Olfr1245	T	C	2: 89,575,034	R231G	probably damaging	Het
Olfr77	A	T	9: 19,920,809	Y200F	probably damaging	Het
Pcdhga10	C	T	18: 37,749,021	P612S	probably damaging	Het
Picalm	A	G	7: 90,191,704	N456S	probably damaging	Het
Pigo	A	G	4: 43,025,084	F5S	probably benign	Het
Pikfyve	T	C	1: 65,230,845	F563S	probably damaging	Het
Pm20d2	A	G	4: 33,174,414	V403A	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rb1cc1	T	A	1: 6,250,113	V1252D	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rmdn3	A	T	2: 119,156,422	H41Q	possibly damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Ror1	A	G	4: 100,442,160	Y910C	possibly damaging	Het
Scn2a	C	T	2: 65,682,031	L171F	probably benign	Het
Sh3pxd2b	A	G	11: 32,411,505	E239G	probably damaging	Het
Snx27	G	T	3: 94,520,235	T311K	probably benign	Het
Sspo	T	A	6: 48,492,490	L4459Q	probably damaging	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thap12	G	T	7: 98,716,663	K679N	probably damaging	Het
Vmn2r65	T	A	7: 84,946,651	H275L	probably benign	Het
Wfs1	C	A	5: 36,968,624	V308L	probably benign	Het
Zfp229	C	A	17: 21,745,862	H358N	probably damaging	Het
Zfp687	T	C	3: 95,007,914	D1092G	probably damaging	Het

Other mutations in Plod2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Plod2	APN	9	92598614	missense	probably damaging	0.99
IGL00945:Plod2	APN	9	92584496	missense	probably benign	0.08
IGL01386:Plod2	APN	9	92606602	missense	probably damaging	0.99
IGL01519:Plod2	APN	9	92595295	missense	probably benign	0.00
IGL01836:Plod2	APN	9	92606498	splice site	probably benign
IGL02490:Plod2	APN	9	92586842	missense	probably benign	0.00
IGL02496:Plod2	APN	9	92607094	missense	probably damaging	1.00
IGL02699:Plod2	APN	9	92607142	missense	probably damaging	1.00
IGL02735:Plod2	APN	9	92595389	splice site	probably benign
IGL03106:Plod2	APN	9	92573567	missense	probably damaging	0.98
R0270:Plod2	UTSW	9	92584521	missense	probably benign	0.10
R0546:Plod2	UTSW	9	92595335	missense	probably damaging	1.00
R0589:Plod2	UTSW	9	92593746	missense	probably benign
R0707:Plod2	UTSW	9	92605427	missense	possibly damaging	0.91
R1491:Plod2	UTSW	9	92606584	missense	probably benign	0.00
R1572:Plod2	UTSW	9	92603067	splice site	probably benign
R1731:Plod2	UTSW	9	92584604	critical splice donor site	probably null
R1895:Plod2	UTSW	9	92607135	missense	probably damaging	1.00
R1917:Plod2	UTSW	9	92581257	missense	probably benign
R1946:Plod2	UTSW	9	92607135	missense	probably damaging	1.00
R3973:Plod2	UTSW	9	92598619	nonsense	probably null
R3974:Plod2	UTSW	9	92598619	nonsense	probably null
R4289:Plod2	UTSW	9	92602988	missense	possibly damaging	0.89
R4423:Plod2	UTSW	9	92601989	missense	probably benign	0.00
R4647:Plod2	UTSW	9	92605450	nonsense	probably null
R4754:Plod2	UTSW	9	92606531	nonsense	probably null
R4769:Plod2	UTSW	9	92595272	missense	probably damaging	1.00
R5279:Plod2	UTSW	9	92581323	missense	probably damaging	1.00
R5535:Plod2	UTSW	9	92606569	missense	probably damaging	1.00
R5654:Plod2	UTSW	9	92593823	missense	probably benign
R5764:Plod2	UTSW	9	92603021	missense	probably damaging	0.97
R5885:Plod2	UTSW	9	92606656	critical splice donor site	probably null
R5940:Plod2	UTSW	9	92591397	missense	probably benign	0.39
R6917:Plod2	UTSW	9	92593770	missense	possibly damaging	0.87
R7109:Plod2	UTSW	9	92573597	missense	probably damaging	1.00
R7221:Plod2	UTSW	9	92584527	missense	probably damaging	1.00
R7311:Plod2	UTSW	9	92584558	missense	probably damaging	1.00
R7963:Plod2	UTSW	9	92605446	missense	probably benign	0.07
R8205:Plod2	UTSW	9	92542318	start gained	probably benign
R8794:Plod2	UTSW	9	92600748	missense	probably damaging	0.98
R8873:Plod2	UTSW	9	92607059	intron	probably benign
R9044:Plod2	UTSW	9	92607220	missense	probably damaging	0.97
R9071:Plod2	UTSW	9	92602995	missense	probably benign	0.09
R9120:Plod2	UTSW	9	92542327	start gained	probably benign
Z1088:Plod2	UTSW	9	92603035	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAGTCCGCTCAATCCTCTC -3'
(R):5'- TTTAGCTCAGCTTCCGAACACC -3'

Sequencing Primer
(F):5'- TTCGGTACCCACGCAGTC -3'
(R):5'- AGGATGGCAAGCTGCTTC -3'

Posted On

2015-04-06