Mutagenetix > Incidental Mutations

Incidental Mutation 'R3850:Mrc2'

275888

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

040898-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3850 (G1)

Quality Score

128

Status

Validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 105292903 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

probably null
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000021038

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100335

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126931

Meta Mutation Damage Score

0.9590

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.0%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066B19Rik	G	A	18: 35,728,714	V84I	probably benign	Het
Abca1	C	T	4: 53,061,481		probably benign	Het
Abcc5	A	T	16: 20,372,156	S815T	probably benign	Het
Adamts17	T	A	7: 66,840,467	L99Q	possibly damaging	Het
Adamtsl1	A	T	4: 86,418,546	Q1564L	probably damaging	Het
Als2cl	A	G	9: 110,889,309		probably benign	Het
Antxrl	C	A	14: 34,067,381	H309Q	probably benign	Het
Ap1g2	T	C	14: 55,104,906	M165V	probably benign	Het
Cacna2d3	A	G	14: 29,347,120		probably null	Het
Cdh16	T	C	8: 104,617,841	D22G	possibly damaging	Het
Cdh17	A	G	4: 11,785,201	D331G	probably damaging	Het
Csmd1	C	G	8: 16,079,922	V1729L	probably benign	Het
Cul5	T	G	9: 53,617,986	M800L	probably benign	Het
Cwf19l1	T	C	19: 44,131,498	Y68C	probably benign	Het
Dst	C	T	1: 34,189,274	Q1658*	probably null	Het
Dst	C	T	1: 34,212,319	S4165F	probably damaging	Het
Fan1	T	C	7: 64,372,371	Y378C	probably damaging	Het
Fat4	T	A	3: 39,007,261	V4331D	probably benign	Het
Fbxl8	T	C	8: 105,267,149	S46P	probably benign	Het
Golgb1	C	A	16: 36,898,733	Q334K	probably benign	Het
Hoxc10	T	C	15: 102,967,444	V196A	probably benign	Het
Hsf4	T	C	8: 105,270,837	F101L	probably damaging	Het
Hydin	T	C	8: 110,563,929	I3340T	probably damaging	Het
Igfbpl1	C	T	4: 45,826,426	R123H	probably benign	Het
Mov10l1	A	T	15: 89,005,695		probably null	Het
Muc5b	G	A	7: 141,862,638	C3107Y	possibly damaging	Het
Naip2	A	T	13: 100,179,432	L280Q	probably damaging	Het
Naip2	G	C	13: 100,179,433	L280V	probably damaging	Het
Nek1	T	A	8: 61,072,315	F596I	probably damaging	Het
Nfasc	T	C	1: 132,631,733	T214A	probably damaging	Het
Olfr1107	T	A	2: 87,071,966	H56L	possibly damaging	Het
Olfr1245	T	C	2: 89,575,034	R231G	probably damaging	Het
Olfr77	A	T	9: 19,920,809	Y200F	probably damaging	Het
Pcdhga10	C	T	18: 37,749,021	P612S	probably damaging	Het
Picalm	A	G	7: 90,191,704	N456S	probably damaging	Het
Pigo	A	G	4: 43,025,084	F5S	probably benign	Het
Pikfyve	T	C	1: 65,230,845	F563S	probably damaging	Het
Plod2	A	G	9: 92,542,545	E29G	probably benign	Het
Pm20d2	A	G	4: 33,174,414	V403A	probably damaging	Het
Proz	A	G	8: 13,073,533	E268G	probably benign	Het
Rb1cc1	T	A	1: 6,250,113	V1252D	probably benign	Het
Rimbp3	A	T	16: 17,210,299	H529L	probably benign	Het
Rmdn3	A	T	2: 119,156,422	H41Q	possibly damaging	Het
Rnf17	T	C	14: 56,512,296	V1433A	probably damaging	Het
Ror1	A	G	4: 100,442,160	Y910C	possibly damaging	Het
Scn2a	C	T	2: 65,682,031	L171F	probably benign	Het
Sh3pxd2b	A	G	11: 32,411,505	E239G	probably damaging	Het
Snx27	G	T	3: 94,520,235	T311K	probably benign	Het
Sspo	T	A	6: 48,492,490	L4459Q	probably damaging	Het
Syne2	T	C	12: 76,048,622	L5241P	probably damaging	Het
Tas2r110	T	A	6: 132,868,675	I223N	probably damaging	Het
Tead2	T	A	7: 45,232,328		probably null	Het
Thap12	G	T	7: 98,716,663	K679N	probably damaging	Het
Vmn2r65	T	A	7: 84,946,651	H275L	probably benign	Het
Wfs1	C	A	5: 36,968,624	V308L	probably benign	Het
Zfp229	C	A	17: 21,745,862	H358N	probably damaging	Het
Zfp687	T	C	3: 95,007,914	D1092G	probably damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7640:Mrc2	UTSW	11	105332295	missense	possibly damaging	0.48
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACACTGGGATCCTTGTGGAC -3'
(R):5'- GCTCCCAGAAAAGTGGAGAC -3'

Sequencing Primer
(F):5'- TCATCTGAGCACAGCGC -3'
(R):5'- TCCAGTCACACACACACAC -3'

Posted On

2015-04-06