Incidental Mutation 'R3850:Cacna2d3'
ID 275892
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 040898-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3850 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 29069077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225733] [ENSMUST00000225863]
AlphaFold Q9Z1L5
Predicted Effect probably null
Transcript: ENSMUST00000022567
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225733
Predicted Effect probably benign
Transcript: ENSMUST00000225863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225953
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C T 4: 53,061,481 (GRCm39) probably benign Het
Abcc5 A T 16: 20,190,906 (GRCm39) S815T probably benign Het
Adamts17 T A 7: 66,490,215 (GRCm39) L99Q possibly damaging Het
Adamtsl1 A T 4: 86,336,783 (GRCm39) Q1564L probably damaging Het
Als2cl A G 9: 110,718,377 (GRCm39) probably benign Het
Antxrl C A 14: 33,789,338 (GRCm39) H309Q probably benign Het
Ap1g2 T C 14: 55,342,363 (GRCm39) M165V probably benign Het
Cdh16 T C 8: 105,344,473 (GRCm39) D22G possibly damaging Het
Cdh17 A G 4: 11,785,201 (GRCm39) D331G probably damaging Het
Csmd1 C G 8: 16,129,936 (GRCm39) V1729L probably benign Het
Cul5 T G 9: 53,529,286 (GRCm39) M800L probably benign Het
Cwf19l1 T C 19: 44,119,937 (GRCm39) Y68C probably benign Het
Dst C T 1: 34,228,355 (GRCm39) Q1658* probably null Het
Dst C T 1: 34,251,400 (GRCm39) S4165F probably damaging Het
Fan1 T C 7: 64,022,119 (GRCm39) Y378C probably damaging Het
Fat4 T A 3: 39,061,410 (GRCm39) V4331D probably benign Het
Fbxl8 T C 8: 105,993,781 (GRCm39) S46P probably benign Het
Golgb1 C A 16: 36,719,095 (GRCm39) Q334K probably benign Het
Hoxc10 T C 15: 102,875,879 (GRCm39) V196A probably benign Het
Hsf4 T C 8: 105,997,469 (GRCm39) F101L probably damaging Het
Hydin T C 8: 111,290,561 (GRCm39) I3340T probably damaging Het
Igfbpl1 C T 4: 45,826,426 (GRCm39) R123H probably benign Het
Mov10l1 A T 15: 88,889,898 (GRCm39) probably null Het
Mrc2 T C 11: 105,183,729 (GRCm39) probably null Het
Muc5b G A 7: 141,416,375 (GRCm39) C3107Y possibly damaging Het
Naip2 A T 13: 100,315,940 (GRCm39) L280Q probably damaging Het
Naip2 G C 13: 100,315,941 (GRCm39) L280V probably damaging Het
Nek1 T A 8: 61,525,349 (GRCm39) F596I probably damaging Het
Nfasc T C 1: 132,559,471 (GRCm39) T214A probably damaging Het
Or4a72 T C 2: 89,405,378 (GRCm39) R231G probably damaging Het
Or5aq1b T A 2: 86,902,310 (GRCm39) H56L possibly damaging Het
Or7d10 A T 9: 19,832,105 (GRCm39) Y200F probably damaging Het
Pcdhga10 C T 18: 37,882,074 (GRCm39) P612S probably damaging Het
Picalm A G 7: 89,840,912 (GRCm39) N456S probably damaging Het
Pigo A G 4: 43,025,084 (GRCm39) F5S probably benign Het
Pikfyve T C 1: 65,270,004 (GRCm39) F563S probably damaging Het
Plod2 A G 9: 92,424,598 (GRCm39) E29G probably benign Het
Pm20d2 A G 4: 33,174,414 (GRCm39) V403A probably damaging Het
Proz A G 8: 13,123,533 (GRCm39) E268G probably benign Het
Rb1cc1 T A 1: 6,320,337 (GRCm39) V1252D probably benign Het
Rimbp3 A T 16: 17,028,163 (GRCm39) H529L probably benign Het
Rmdn3 A T 2: 118,986,903 (GRCm39) H41Q possibly damaging Het
Rnf17 T C 14: 56,749,753 (GRCm39) V1433A probably damaging Het
Ror1 A G 4: 100,299,357 (GRCm39) Y910C possibly damaging Het
Scn2a C T 2: 65,512,375 (GRCm39) L171F probably benign Het
Sh3pxd2b A G 11: 32,361,505 (GRCm39) E239G probably damaging Het
Smim33 G A 18: 35,861,767 (GRCm39) V84I probably benign Het
Snx27 G T 3: 94,427,542 (GRCm39) T311K probably benign Het
Sspo T A 6: 48,469,424 (GRCm39) L4459Q probably damaging Het
Syne2 T C 12: 76,095,396 (GRCm39) L5241P probably damaging Het
Tas2r110 T A 6: 132,845,638 (GRCm39) I223N probably damaging Het
Tead2 T A 7: 44,881,752 (GRCm39) probably null Het
Thap12 G T 7: 98,365,870 (GRCm39) K679N probably damaging Het
Vmn2r65 T A 7: 84,595,859 (GRCm39) H275L probably benign Het
Wfs1 C A 5: 37,125,968 (GRCm39) V308L probably benign Het
Zfp229 C A 17: 21,964,843 (GRCm39) H358N probably damaging Het
Zfp687 T C 3: 94,915,225 (GRCm39) D1092G probably damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4681:Cacna2d3 UTSW 14 29,015,092 (GRCm39) missense probably damaging 1.00
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AGGACACTGTTTGCTTGGCG -3'
(R):5'- CCAGAGATGGATGAGCAGTC -3'

Sequencing Primer
(F):5'- GATGGTCAAGCGGAGTCCTTTC -3'
(R):5'- AGCTGCTGCATTGTGCC -3'
Posted On 2015-04-06