Mutagenetix > Incidental Mutation

Incidental Mutation 'R3851:Shroom3'

275916

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

040899-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3851 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92943086 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 1151 (V1151F)

Ref Sequence

ENSEMBL: ENSMUSP00000153516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000168878
AA Change: V1101F

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200869

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap1	G	A	7: 101,390,165	W544*	probably null	Het
AY358078	A	G	14: 51,805,553	T233A	unknown	Het
Bcl9	G	A	3: 97,209,653	P575L	probably damaging	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Cry1	C	A	10: 85,146,499	A328S	probably benign	Het
Dclre1a	A	T	19: 56,541,507	N799K	probably damaging	Het
Dnm3	A	T	1: 162,321,127		probably null	Het
Dock9	A	T	14: 121,629,086		probably null	Het
Dpysl4	C	T	7: 139,100,935	T575M	probably damaging	Het
Drc7	C	T	8: 95,061,836	Q276*	probably null	Het
Dzip3	T	C	16: 48,950,013	T389A	possibly damaging	Het
Fam196a	A	G	7: 134,884,526	V432A	probably benign	Het
Flnc	T	A	6: 29,453,719	L1801Q	probably damaging	Het
Fmo9	A	G	1: 166,663,367	L463P	probably benign	Het
Fnip2	G	C	3: 79,462,157	H1074D	probably damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
H2-Q5	T	A	17: 35,394,139	M5K	unknown	Het
Il27ra	C	T	8: 84,040,688	E169K	probably benign	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Lhfpl3	G	A	5: 22,775,987		probably benign	Het
Map4k3	A	G	17: 80,644,323		probably benign	Het
Mas1	C	G	17: 12,841,993	S181T	probably benign	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Nubpl	T	C	12: 52,144,027	M65T	probably damaging	Het
Olfr813	A	C	10: 129,857,147	M210L	probably benign	Het
Parp14	A	G	16: 35,853,748	I1042T	possibly damaging	Het
Pcdh15	C	A	10: 74,631,686	S1779Y	probably damaging	Het
Pgm5	C	T	19: 24,820,203	R205Q	probably damaging	Het
Radil	T	C	5: 142,506,997	D292G	probably damaging	Het
Rbp3	C	A	14: 33,955,507	H471N	probably damaging	Het
Rgs14	T	A	13: 55,379,614	L221Q	possibly damaging	Het
Rrm2	G	T	12: 24,708,599	A47S	probably benign	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Sult2b1	G	T	7: 45,730,037		probably benign	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Zfp521	T	C	18: 13,717,751		probably benign	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- CTGTGTCTTAACTGTCAGAACGG -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- GTGTCTTAACTGTCAGAACGGTAACC -3'

Posted On

2015-04-06